1С штрих: 1С Штрих М купить — самая выгодная цена на официальном сайте

Содержание

Комплект: конфигурация «Штрих-М: Торговое предприятие 5 (USB)» + 1С: Бухгалтерия 8

Функциональные возможности

Работа с ЕГАИС:

  • внесение остатков алкоголя в ЕГАИС;
  • акт списания алкоголя;
  • подтверждение прихода алкогольной продукции в соответствии с требованиями ЕГАИС;
  • акт разногласия;
  • автоматическое формирование журнала розничных продаж алкоголя.

Ведение партионного учёта остатков товаров на складах предприятия и в торговых залах:

  • По каждому складу ведется учёт остатков и стоимости товаров в закупочных ценах, а на розничных складах учёт стоимости товаров ведётся также и в розничных ценах;
  • Списание товаров выполняется по одному из методов FIFO, LIFO, по среднему в зависимости от настроек.

Реализация основных этапов товародвижения:

  • Поступление товаров от поставщиков, возврат товаров поставщикам;
  • Перемещение товаров между складами;
  • Ценообразование и переоценка товаров, включая автоматическую при поступлении товара на склад по новой розничной цене;
  • Оптовая и розничная реализация товаров, возвраты от покупателей;
  • Инвентаризация, оприходование излишков, списание товаров, перевод товаров в некондицию;
  • Заказы поставщикам, корректировка заказов, формирование заказов по графику;
  • Опциональный контроль разрешения поставки номенклатуры поставщиком.

Учет специфики розничной торговли:

  • Работа с дисконтными и платежными картами;
  • Подарочные сертификаты;
  • Ведение статистики по ККМ и кассирам;
  • Аналитика по операциям сторно и отменам чеков;
  • Настройка маркетинговых акций и различных настроек POS-систем;
  • Аналитика по маркетинговым акциям;
  • Учет продаж продавцов;
  • Учет превышений розничных продаж;
  • Анализ итогов инвентаризации;
  • Пересортица;
  • Планирование переоценок;
  • Региональные декларации о розничном обороте алкогольной продукции.

Реализация работы с покупателями через систему заказов:

  • Реализация основных элементов схемы работы: формирование заказа покупателя, резервирование под заказ, отгрузка по заказу;
  • Ведение условий отгрузок по заказам покупателей;
  • Формирование заказов поставщикам под заказы покупателей;
  • Контроль состояния заказа покупателя.

Ведение взаиморасчётов с контрагентами:

  • Ведение взаиморасчётов в разрезе договоров и документов поставки;
  • Контроль задолженности предприятия перед поставщиками и задолженности покупателей перед предприятием.

Учёт денежных средств предприятия:

  • Оформление кассовых и банковских документов;
  • Контроль денежных средств на расчётных счетах и в кассах предприятия.

Учёт торговой деятельности по реализации:

  • Контроль остатков и стоимости товаров, как взятых, так и отданных на реализацию;
  • Автоматическое начисление долга поставщикам по мере продажи товаров, взятых на реализацию;
  • Контроль взаиморасчётов с поставщиками по товарам, взятых на реализацию.

Отчётность:

  • Товарная отчётность: остатки и движения товаров, заказы товаров;
  • Взаиморасчёты с контрагентами;Денежные средства;
  • Контроль минимальных остатков и сроков реализации;
  • История цен;
  • Аналитическая отчётность: анализ продаж, ABC- и XYZ-анализ номенклатуры, ABC-анализ контрагентов;
  • Регламентированная отчётность.

Обмен данными с конфигурациями бухгалтерского учёта:

Поддержка выгрузки на уровне документов и /или на уровне проводок;

Выгрузка данных может осуществляться:

  • Выгрузка данных в конфигурацию «1С: Бухгалтерия предприятия 8» версий 1.6, 2.0, 2.0 КОРП;
  • Выгрузка данных в конфигурацию «1С: Бухгалтерия 7.7»;
  • Выгрузка данных в конфигурацию «1С: Упрощённая система налогообложения 7. 7» и т.д.

Для конфигурации «1С: Бухгалтерия предприятие 8» версий 1.6, 2.0, 2.0 КОРП, поддерживается двусторонний обмен данными.

Торговое предприятие 5. (Базовая версия)

Функциональные возможности

» Ведение партионного учёта остатков товаров на складе предприятия и в торговых залах:
По каждому складу ведётся учёт остатков и стоимости товаров в закупочных ценах, а на розничных складах учёт стоимости товаров ведётся также и в розничных ценах;
Списание товаров выполняется по одному из методов FIFO, LIFO, по среднему в зависимости от настроек.
» Учёт товаров в разрезе произвольного количества дополнительных характеристик;
» Реализация основных этапов товародвижения:

Поступление товаров от поставщиков, возврат товаров поставщикам;
Перемещение товаров между складами;
Ценообразование и переоценка товаров, включая автоматическую при поступлении товара на склад по новой розничной цене;
Оптовая и розничная реализация товаров, возвраты от покупателей;
Инвентаризация, оприходование излишков, списание товаров, перевод товаров в некондицию;
» Учёт специфики розничной торговли:
Работа с дисконтными и платёжными картами;
Подарочные сертификаты;
Ведение статистики по ККМ и кассирам;
Аналитика по операциям сторно и отменам чеков;
Настройка маркетинговых акций и различных настроек POS-систем;
Аналитика по маркетинговым акциям;
Учёт продаж продавцов;
Учёт превышений розничных продаж;
Анализ итогов инвентаризации;
Пересортица;
» Ведение взаиморасчётов с контрагентами;
» Учёт денежных средств предприятия:
Оформление кассовых и банковских документов;
Контроль денежных средств на расчётных счетах и в кассах предприятия.
Ограничения базовой версии
«Штрих-М: Торговое предприятие 5. Базовая версия» — это однопользовательская программа для организации управленческого учета на предприятиях оптово-розничной торговли. По сравнению с основной поставкой, она имеет ряд ограничений.
Функциональные ограничения:
» Не ведётся учёт в разрезе серийных номеров и дополнительных расходов
» Нет возможности работы с товаром принятым на комиссию
» Нет возможности работы с комплексами этикетирования
Технологические ограничения:
» Не поддерживается изменение конфигурации, можно применять только типовую конфигурацию и устанавливать ее обновления;
» Одновременно с одной информационной базой может работать только один пользователь;
» Не поддерживается работа в варианте клиент-сервер;
» Не поддерживается работа распределенных информационных баз;
» Не поддерживается COM-соединение и Automation-сервер.

Отчётность
» Товарная отчётность: остатки и движения товаров, заказы товаров;
» Взаиморасчёты с контрагентами;
» Денежные средства;
» Контроль минимальных остатков и сроков реализации;
» История цен;
» Аналитическая отчётность: анализ продаж, ABC- и XYZ-анализ номенклатуры, ABC-анализ контрагентов;
» Регламентированная отчётность.
Обмен данными с конфигурациями бухгалтерского учёта
» Поддержка выгрузки на уровне документов и /или на уровне проводок;
» Выгрузка данных может осуществляться:
Выгрузка данных в конфигурацию «1С: Бухгалтерия предприятия 8» версий 1.6, 2.0, 2.0 КОРП;
Выгрузка данных в конфигурацию «1С: Бухгалтерия 7.7»;
Выгрузка данных в конфигурацию «1С: Упрощённая система налогообложения 7.7» и т.д.

» Для конфигурации «1С: Бухгалтерия предприятие 8» версий 1.6, 2.0, 2.0 КОРП, поддерживается двусторонний обмен данными

Характеристики товара
Страна производитель: Россия
Артикул43761

Хорошо ли описан данный товар?

Торговое предприятие 7 от компании Штрих-М

Подписка Расширенная подписка Версия

Работа со СБИС ЭДО (Тензор)

      7.
0.10.1                  
Работа с СБИС ЭДО (Тензор) реализована через обработку Sbis1C, разработанной компанией Тензор.
 

+

В форме «Настройки учета» добавлена закладка «ЭДО». На закладке указывается каталог, в котором будет располагаться обработка Sbis1C, а также кнопка выгрузки обработки. Также на закладке размещены ссылки на регистрацию в личном кабинете СБИС ЭДО, ссылки на SBIS плагин и SBIS SDK, установка которых необходима для работы обработки.

 

+

Реализовано получение по ЭДО входящих документов: Приходная накладная, приходная накладная реализации, возврат от покупателя, акт разногласия, счет-фактура полученная. Получение реализовано через форму обработки Sbis1C.

 

+

Реализована выгрузка в каналы ЭДО исходящих документов: Расходная накладная, Возврат поставщику, Корректировка отгрузки, Счет-фактура выданная. Выгрузка документов осуществляется из формы обработки Sbis1C.

 

+

Получение входящих документов по ЭДО реализовано по схеме предварительной приемки. Данные о товарном составе документа загружаются в промежуточный документ «ЭДО Сверка поступления», в котором осуществляется сравнение данных поставщика с фактическими данными поставки.

Данные сверяются по составу накладной, по суммам и количествам и кодам маркировки. Исходя из результатов сравнения, документ может быть подписан или отклонен. На отклоненный документ поставщик может выслать исправление, которое будет загружено в этот же документ. При этом произойдет автоматическое сопоставление с уже введенными данными сверки. Это позволяет быстро понять, все ли замечания по документу учтены поставщиком и исправлены. Подписанный документ отражается в учете по кнопке «Отразить в учете». Вид учетного документа определяется пользователей в форме документа «ЭДО Сверка поступления».

 

+

Удобной пошаговой инструмент автоматизации процесса проведения инвентаризации и и отражения их в учете — «Пересчет товаров»
 

+

Добавлены новые методыweb-сервиса «MarkControl»

GetMarkInfo – возвращает информацию по акцизной марке: номенклатуру и статус марки, а также массив секций, по которым данная марка может быть продана.

 

+

Подбор товара по акцизной марке алкогольной продукции нового образца. Можно не считывать штрих-код товара и акцизную марку, а считать только акцизную марку. Программа сама подставит номенклатуру и цену товара;

 

+

Добавлен документ «Ваучер TaxFree». Данный документ служит для отражения факта оформления возврата налога Tax Free на ККМ «Штрих-М Кассир, версия 5» и возможности повторного запроса печатной формы в системе «Global Blue».

+

+ 7.0.11.1    

Маркировка

Для импортеров и производителей обуви. Добавлена возможность получения кодов маркировки на импортируемую продукцию и собственное производство (В документе «ГИС МТ: Получение кодов маркировки (из СУЗ)»)

+

+
Для импортеров и производителей обуви.Добавлена возможность вводить коды маркировки в оборот при собственном производстве, импорте, трансграничной торговле, при получении товаров от физических лиц

+

+
Для ККМ с типом «POS-Система на базе «Штрих-М Кассир v. 1.x / 2.x»» в строке товара добавлена выгрузка типа маркировки. ВАЖНО. Штрих-М Кассир v. 1.x / 2.x давно снят с производства и для работы с маркируемым товаром не подходит. Необходим апгрейд на Штрих-М Кассир 5. Подробности у партнеров.

+

+
Маркетинговая акция. Добавлен механизм создания маркетинговых акций (Документ «Маркетинговая акция») по изменению цены на товар (закупочной по поставщикам/договорам) и розничной (по складам) на период действия акции. Изменения розничных цен возможно как через документ «Акт о переоценке», так и документ «Планирование изменения розничных цен».
 

+

                 7.0.12.01

Маркировка

Загрузка документов по маркировке из ГИС МТ минуя ЭДО.  Полная или частичная приемка из ГИС МТ маркированной продукции, отклонение документа при большом количестве расхождений, осуществляется в том случае, когда маркированная продукция была загружена в ГИС МТ без участия ЭДО. Загрузка документа «ЭДО Сверка поступления из ГИС МТ» осуществляется по идентификатору документа отгрузки, доступному в личном кабинете ГИС МТ.
 

+

Вывод из оборота. Добавлен и доработан документ «ГИС МТ: Вывод из оборота». Документ используется для вывода маркируемой продукции из оборота в ГИС МТ и по данным базы данных. Документ может быть заполнен автоматически из формы документа «Отчёт отдела». Оформлять документ следует в случаях, когда ККТ работает в автономном режиме и не передаёт чеки в ОФД, либо же у предприятия не оформлен договор с ОФД на передачу данных о проданных кодах маркировки в ГИС МТ.

+

+
Печать кодов маркировки возвращенного товара. Добавлено автоматическое формирование документа «ГИС МТ: Печать кодов маркировки» при получении транзакции с типом «180» из кассовой программы. Документ используется для печати кодов маркировки возвращенного товара, для которого при возврате код маркировки был выбран на ККМ вручную.

+

+
Связь кодов маркировки с номенклатурой. Добавлен документ «ГИС МТ: Корректировка статусов кодов маркировки». Документ используется для связи кодов маркировки (не связанных с номенклатурой) с номенклатурой, а также для произвольной смены статусов кодов маркировки в базе данных.

+

+

Модуль «Кассир»

Формирование фискальных документов при работе с маркируемой продукцией в соответствии с изменениями, вступающими в силу с 01.03.2020, включая передачу в ОФД маркированного товара, марок акцизной алкогольной продукции и КИЗ меховых изделий

+

+
Добавлена работа с сервисом TaxFree (Global Blue IC2) 

+

+

Маркировка

7.0.13.01

Добавлена возможность групповой загрузки из ГИС МТ документов «ЭДО: Сверка поступления» за период
 

+

Вывод из оборота минуя ОФД. Добавлена возможность автоматического заполнения документов «ГИС МТ: Вывод товара из оборота» кодами маркировки, которые по данным ТП есть на учете в ЦРПТ, но их нет на остатках указанное число дней.
 

+

Добавлен документ «ГИС МТ: Сверка состояния кодов маркировки с ГИС». Данный документ позволяет получить из ГИС МТ все коды маркировки, которые числятся на учете предприятия. При проведении документ ставит на учет по фирме документа коды маркировки, которых не было на учете.

+

+
Добавлен документ «ГИС МТ: Агрегация короба». Документ позволяет агрегировать индивидуальные, групповые и транспортные упаковки в новую упаковку.

+

+
Добавлен документ «ГИС МТ: Разбор короба». Документ позволяет разобрать групповой или транспортный код маркировки и поставить вложенные в короб коды маркировки на учет предприятия.

+

+

Маркировка

      7.0.14.01                                
Реализован документ «ГИС МТ Отгрузка», позволяющий выполнить операции продажи / возврата поставщику маркированных товаров через ГИС МТ без использования ЭДО. Документ поддерживает следующие виды операций: отгрузить товары другой организации / ИП без вывода из оборота, отгрузить товары другой организации / ИП с выводом из оборота и отгрузить товары гос. структуре по гос. контракту
 

+

Виджеты

Добавлены следующие возможности в виджете «Показатели работы ККМ»: текущий режим работы кассы, текущий пользователь кассового ПО, данные о наличии связи с УТМ и ОФД, данные о варианте обмена на кассе и состоянии обмена, данные о наличии связи с веб и http-сервисами, данные о текущих продажах, чеков возвратов, операций сторно и обмен, информация о наличии ошибок в работе кассы и информация о версии установленного ПО, платформы 1С: Предприятие 8 и модулей логики
 

+

ЕГАИС

Добавлена сервисная обработка «Исправление дат документов на дату принятия в ЕГАИС»

+

+
В документе «ЕГАИС Запрос акцизных марок» изменена логика работы

+

+
Для упрощения перевода всей маркированной продукции на учет в 1-й и 3-й регистры ЕГАИС, в документе «ЕГАИС Перемещение» добавлена опциональная проверка на то, что все считанные в документе акцизные марки соответствуют количествам перемещаемой в 1-й регистр номенклатуры ЕГАИС

+

+
В документе «ЕГАИС Акт фиксации» добавлен ввод на основании документа «ЕГАИС Перемещение». Это нужно для быстрой постановки марок на учет в 3-й регистр. Маркированная продукция перемещается из торгового зала в ЕГАИС в 1-й регистр, при оформлении документа сразу считываются акцизные марки перемещаемых бутылок, что позволяет еще на этапе перемещения выполнить контроль перемещаемой продукции. Далее считанные акцизные марки переносятся в акт фиксации, что исключает их повторное считывание.

+

+
Добавлена константа «Дата окончания переходного периода», которая позволяет настроить дату, начиная с которой работа в ЕГАИС завершается переходный период и весь маркированный алкоголь должен учитываться на 3-м регистре

+

+
Теперь документ «ЕГАИС Перемещение» не позволит переместить в Торговый зал ЕГАИС маркированную продукцию, дата раздела А которой не известна или больше чем дата запрета перемещения в торговый зал маркированной продукции. Также в документ не будет подставлен маркированный алкоголь вне зависимости от его даты розлива, если переходный период учета маркированной продукции завершен, и вся маркированная продукция может учитываться только на помарочном учете.

+

+
В документе «ЕГАИС Поступление» добавлена возможность загрузки акцизных марок из документа «Выгрузка из ТСД»

+

+
В документе «ЕГАИС Расход» добавлена возможность загрузки акцизных марок из документа «Выгрузка из ТСД»

+

+

Маркировка

Учтены новые требования постановления Правительства Российской федерации от 16 апреля 2020 г. N 521 о передаче данных в ОФД, требующих заполнения тега 1162 (код товара) фиксированными значениями для некоторых товарных позиций. В справочнике «Номенклатура» на закладке «ККМ» добавлен реквизит «Код товара для передачи в ОФД». Значение этого реквизита будет выгружаться в одноименный реквизит кассового ПО и передаваться в ККТ в теге 1162 при продаже товара.

+

+

Иное

Добавлен новый вариант редактирования и хранения настроек кассовых программ «Штрих-М: Кассир 5». Теперь редактирование настроек можно осуществлять в форме кассовой программы. Для редактирования доступны практически все настройки кассы, кроме индивидуальных (имена и пути файлов, номера последних транзакций). В том числе можно отредактировать внешний вид формы чека. Отредактированные настройки выгружаются на кассы при любом способе обмена. Эта доработка позволяет выполнять практически любые операции по изменению настроек касс непосредственно из товароучетной конфигурации. Важно! Функциональность по редактированию настроек касс из интерфейса кассовой программы доступна при наличии модуля «Кассир».

+

+

Маркировка

  7.0.15.01                             
Реализован первый этап интеграции с сервисом ЭДО Лайтсозданным компанией ЦРПТ
 

+

Реализована интеграция с оператором Такском
 

+

Реализована возможность заполнять документ ЭДО Сверка поступления из XML-файла УПД или УКД, полученного в личном кабинете оператора ЭДО
 

+

Автоматическое подставление, в учетных документах, варианта расчета НДС значения “Без НДС
 

+

Корректная загрузка полных кодов маркировки
 

+

Приходные цены в документе указываются за единицу измерения, а не базовую единицу измерения, как было ранее
 

+

Автоматическое заполнение номенклатуры из СБИС ЭДО
 

+

Улучшено заполнение единиц измерения
 

+

ЕГАИС

Добавлена возможность отмены акта фиксации акцизных марок в ЕГАИС

+

+

Работа с оборудованием

При подборе документов в документ «Z-отчет», которые ранее не попали ни в один документ отчета, добавлен отбор по номеру смены

+

+

Иное

Добавлено заполнение документа «Ваучер TaxFree» новыми данными пришедшими с ККМ «Штрих-М: Кассир, версия 5» при оформлении ваучера через систему «Планет Пеймент Рус». Реализована повторная печать данных ваучеров

+

+
Добавлена возможность редактирования дополнительных реквизитов номенклатуры через групповую обработку

+

+

Маркировка

7.0.16.01
Автоматического создания новых карточек номенклатуры по данным, поступившим от поставщика
 

+

Учтены особенности передачи поставщиками неформализованных единиц измерения, например, блоков и добавлен справочник «Единицы поставщиков», необходимый для сопоставления единиц поставщика с единицами номенклатуры.
 

+

Учтена особенность ГИС МТ, что для ряда запросов и ответов может передаваться не полный код идентификации, а только его часть с GTIN и серийным номером (укороченный код идентификации)
 

+

Добавлен общий модуль «ИСМП_ЭДО_Переопределяемый» используемый лля возможностей самостоятельной доработки и заполнения документа «ЭДО сверка поступления» при загрузке из ЭДО
 

+

Улучшен поиск номенклатуры по коду маркировки при загрузке напрямую из ГИС МТ
 

+

В документе «ЭДО Сверка поступления» учтены ситуации, когда поставщики передают информацию о кодах маркировки в виде нормализованных данных (идентификаторы применения выделены в круглые скобки)
 

+

Актуализирована обработка обмена с ЭДО Такском до последней версии
 

+

Добавлена работа с новыми товарными группами: «Одежда и постельное белье», «Духи и туалетная вода», «Шины»

+

+
В документе «ГИС МТ: Описание остатков» добавлена работа с товарными группами «Одежда и постельное белье» и «Шины»

+

+
В документе «ГИС МТ: Получение кодов маркировки» добавлена работа с новыми товарными группами «Одежда и постельное белье», «Духи и туалетная вода», «Шины»

+

+
В документе «Получение кодов маркировки» добавлена возможность получать новые коды маркировки под процесс перемаркировки товаров

+

+

Биллинг дисконтных карт/дисконтный сервер на базе товароучетной программы:

Централизованный учет сумм бонусов и накоплений на дисконтных картах и прозрачность историю операций по дисконтным картам.
 

+

Механизм «устаревания» бонусов, суммы накопления и количества чеков
 

+

Правило жизни бонусов и накоплений
 

+

Сочетания on/off line операций и защита от дублирования
 

+

ЕГАИС

Запрос остатков акцизных марок по всем справкам 2 (разделам Б) документа числящихся за предприятием в ЕГАИС

+

+

ВетИС

Разделение регламентных заданий — это позволяет настроить разные расписания для получения эВСД и обработки запросов ВЕТИС.

+

+
Переработана обработка «ВетИС: Обработка входящих эВСД». Интерфейс обработки существенно упрощен и улучшен, исходя из поступивших предложений по улучшению и замечаний в работе.Увеличена скорость выдачи следующей информаци: сколько эВСД имеется на каждом хозяйствующем субъекте, быстрее загружаются новые эВСД, выборочный просмотр эВСД, гашение эВСД полностью или по отмеченных хозяйствующим субъектам.

+

+
Регламентное задание «ВЕТИС: Обработка запросов» работает только с запросами ВЕТИС и не отвечает за загрузку эВСД

+

+
Создано новое регламентное задание «Загрузка эВСД», для оперативной загрузки входящих эВСД

+

+

Иное

В отчете «Показатели ККМ» добавлена возможность отображения используемых модулей логики кассовой программы «Штрих-М: Кассир v.5». Для получения данной информации требуется версия кассира 5.1.7.7 и выше
 

+

Интеграция с сервисом автозаказов «КОРУС. Управление запасами»  

+

7.0.17.01                 
Интеграция с сервисом планограмм ABM SHELF
 

+

Работа с электронными ценниками «Pricer»
 

+

Формирование на кассах документов «Списание» и «Списание некондиции»;

+

+
Прием на кассе предоплаты за товар;

+

+
Получение из «Штрих-М: Кассир 5» документа содержащего в себе данные о пересчете купюр для передачи выручки инкассаторам
+ +

Маркировка

Учтены последние изменения в API ЭДО Лайт;  

+

Перемаркировка товара

+

+

Маркировка

7. 0.17.02 

Добавлена работа с товарной группой Фотоаппараты и Фотопродукция. Для товарной группы добавлено автоматическое создание форматов штрих-кодов, поддержано получение кодов маркировки, включая маркировку остатков, добавлена работа с операциями по маркировке.

+

+

Маркировка

                     7.0.18.01                
Маркировка остатков табачной продукции
+
Усовершенствование работы со СБИС ЭДО (Тензор) +
Добавлена возможность работы с новой товарной группой «Фотоаппараты»
+ +
Добавлен контроль количества сверенных кодов маркировки при приемке + +
Сделана регистронезависимая обработка ответа от ГИС МТ для документа «ГИС МТ: Описание остатков» + +

Книга учета доходов и расходов

Переноса части расходов на другие учетные периоды
+
Формирование книги учета и расхода + +

Маркетинговые акции

На замену акции «Изменение цен» добавлена акция «Комплексное изменение цен»
+

Иное

Обмен с ККМ «Артикс» по формату «Артикса» +
Указание причины списания, при создании документов «Списание» и «Списание некондиции» в «Штрих-М: Кассир» + +
Автоматическое создание документа «Расходный кассовый ордер» + +
Проведения документа «Списание некондиции» в превышение + +
Обработка «Платежный календарь» + +
Документ «Перенос планируемых платежей» + +
Механизм контроля заказов + +
Добавлена выгрузка дополнительных параметров в ККМ Артикс 
+  7. 0.18.02  
Добавлена выгрузка дополнительных параметров в ККМ Артикс    +        7.0.18.03

Печать штрих-кода на документах в 1С 8.2

Порою в рамках штрихкодирования документов или этикеток на печатную форму 1С 8.2 (8.3) необходимо вывести произвольный штрих-код.

Как это сделать, рассмотрим ниже.

Первым делом нужно создать шаблон будущей печатной формы. Если у Вас возникли трудности с созданием будущего шаблона, прочтите статью создание печатных форм в 1С.

Для вывода штрих-кода обязательно (кроме конфигураций на базе БСП 2 и выше) необходима установка компонента 1С Печать штрих-кода. Найти его можно на диске ИТС или на пользовательском портале 1С.

Вставка штрих-кода на печатную форму 1С

Первый шаг — необходимо создать новый объект — рисунок. Для этого в макете необходимо нажать Таблица — Рисунки — Вставить объект… Система предложит выбрать тип объекта:

Нужно выбрать Элемент управления 1С.V8.Печать штрих-кодов. Допустим, назовём рисунок-объект «Штрихкод». Для программного вывода на печатную форму можно воспользоваться следующим кодом:

ТипКода = ПолучитьЗначениеТипаШтрихкодаДляЭУ(ПланыВидовХарактеристик.ТипыШтрихкодов.Code39);
Если ТипКода = -1 Тогда
ОбщегоНазначения.СообщитьОбОшибке("Для штрихкода формата """ + ПланыВидовХарактеристик.ТипыШтрихкодов.EAN13
+ """ не существует соответствующего типа в ЭУ ""1С:Печать штрихкодов"".
| Позиция будет пропущена");
КонецЕсли;

Область.Рисунки.Штрихкод.Объект.ТипКода = ТипКода;
Область.Рисунки.Штрихкод.Объект.Сообщение = ?(ПустаяСтрока(""),Штрихкод,"");
Область.Рисунки.Штрихкод.Объект.ТекстКода = Штрихкод;

Если вы только начинаете программировать в 1С или просто хотите систематизировать свои знания — попробуйте Школу программирования 1С нашего друга Владимира Милькина. Пошаговые и понятные уроки даже для новичка с поддержкой учителя.
Попробуйте бесплатно по ссылке >>

В вышеприведенном примере мы вначале получаем тип штрих-кода, потом назначаем рисунку тип штрих-кода и сам штрих-код.

Вот и всё! Установка штрих-кода на печатной форме завершена.

Наш видеоурок по созданию внешних печатных форм и подключению их на примере конфигурации 1С Бухгалтерии:

Если Вы начинаете изучать 1С программирование, рекомендуем наш бесплатный курс (не забудьте подписаться на YouTube — регулярно выходят новые видео):

К сожалению, мы физически не можем проконсультировать бесплатно всех желающих, но наша команда будет рада оказать услуги по внедрению и обслуживанию 1С. Более подробно о наших услугах можно узнать на странице Услуги 1С или просто позвоните по телефону +7 (499) 350 29 00. Мы работаем в Москве и области.

Исправление штрих-кода в отчетности — Полезные статьи

Цифры вместо штрих кода в отчетности? Тогда эта статья — для Вас!Перед решением проблемы нам с Вами нужно детально разобраться, какого из штрих-кодов не хватает на форме отчетности.

 

1. Одномерный штрих-код.

Этот штрих-код расположен в углу каждого листа большенства форм, сдаваемых в налоговую инспекцию.Если вместо вместо красивого штрих-кода Вы видите цифры, это свидетельствует о невозможности программы вывести на экран шрифт EanGnivc, формирующий сам штрих-код.

Итак, какие Ваши действия в этом случае:

  • 1. Необходимо открыть папку с системными шрифтами (Пуск — Панель управления — Шрифты или Start — Control Panel — Fonts)
  • 2. Посмотреть, нет ли среди них шрифта EanGnivc. Если шрифт есть, его необходимо перетащить в любую папку (например — на рабочий стол). При этом в папке (на рабочем столе) появится файл eang000. Затем этот самый файл необходимо перетащить обратно в папку с системными шрифтами. Система может сказать что такой шрифт уже есть, и тем не менее, как правило, эти действия помогают корректно установить штрифт. Переформируйте лист отчета, убедитесь, что штрих код формируется корректно.
  • 3. Если же в папке с системными шрифтами Вы не нашли шрифт EanGnivc, Вам необходимо скачать его с нашего сайта (см. ссылки ниже), затем перетащить скачанный шрифт из папки, в которой Вы его сохранили в открытую нами на первом шаге папку с системными шрифтами, или выбрав в меню Файл — Установить шрифт, выбрать скачанный шрифт. После этого переформируйте лист отчета, убедитесь, что штрих код формируется корректно.

2. Двухмерный штрих-код.

Этот штрих код выглядит как прямоугольники, заполненные белыми и черными квадратами. Располагается двухмерный штрих-код по одной из сторон каждого листа.

В штрих-коде закодирована информация, содержащаяся на листе формы отчетности. В налоговой инспекции штрих-код считывают специальными сканерами, автоматизируя ввод информации в систему. Итак, если штрих кода нет:

Если вы пользователь 1С:Предприятия версии 7.7, вам необходимо открыть титульный лист декларации, выбрать закладку «Настройка печати» — если Вы видите среди настроек флажок «Формировать двухмерный штрих-код», значит штрих код у Вас установлен. Все что Вам нужно сделать, что бы он появился на декларации — установить флажок, заполнить все необходимые листы, затем открыть титульный лист и нажав на кнопку «Печать» выбрать опцию «Показать бланки всех листов» либо «Напечатать все листы».

Если у Вас устанволено 1С:Предприятие 8, Вам необходимо открыть форму декларации, нажать кнопку «Настройка» в верхней части формы, убедится что флажок «Наносить двухмерный штрих-код» установлен. При печати декларации двухмерный штрих-код будет выведен автоматически.

Если же вы не нашли флажков «Выводить двухмерный штрих-код» или «Наносить двухмерный штрих-код», тогда Вам следует скачать с нашего сайта (см. ссылки ниже) и установить файл пакета установки компоненты двухмерного штрих-кода.Файлы для установки штрих кода:

Штрих-Мпей-Ф + 1С:Касса – проще некуда? в Смоленске в Легасофт.

Сегодня в наши руки попал необычный продукт – связка облачного сервиса «1С:Касса» и контрольно-кассового аппарата Штрих-Мпей-Ф. Давайте рассмотрим их подробнее.

Начать стоит с аппаратной составляющей — самой машинки Штрих-М.

ККТ представляет из себя миниатюрный аппарат, размером чуть больше, чем стандартные эквайринговые терминалы. Чёрная глянцевая лицевая панель с органами управления смотрится строго и стильно. Габариты: 80х210х71 (Ширина x Глубина x Высота). Это является огромным плюсом. Такие размеры делают его чуть ли не самым миниатюрным аппаратом из всех представленных на рынке. Если у вас мало места на прилавке торговой точки – эта ККТ вместе со сканером штрих-кодов и устройством для приёма банковских карт займёт места даже меньше чем Эвотор (обзор на него вы можете найти у нас на сайте). Более того, в отличии от Эвотора, Штрих имеет встроенный аккумулятор на 1400 миллиампер-часов (а это около 500 чеков без подзарядки). Размеры + автономность – чем не решение для разъездной торговли? Терминал легко поместится в бардачок практически любого авто, влезет в небольшую сумку, даже в карман куртки. Курьер с коробками пиццы легко сможет взять его с собой из машины, чтобы выбить чек прямо у дверей клиента. Это поможет минимизировать проблемы при отмене заказа, не нужно будет делать возврат чека, как в ситуации, когда курьер приезжает уже с выбитым в ресторане чеком.

Питание от встроенной аккумуляторной батареи с номинальным напряжением 7.4 В и номинальной ёмкостью 1.4 Ач, с возможностью подзарядки через адаптер с напряжением 12В ± 2В. До 500 чеков на одной зарядке.

Как мы видим из характеристик, ККТ заряжается от 12 вольт, что позволяет заряжать её от бортовой сети автомобиля, нужно будет лишь приобрести необходимый кабель, или даже сделать его самим при необходимости. Производитель постарался сделать максимум удобств для курьерской службы.

Терминал оснащён простейшими органами управления – стандартная цифровая клавиатура, четыре кнопки для навигации, кнопки «Отмена», «Del», «Питание», «ОК» и две функциональные клавиши под экраном. Всё намного проще, чем у ближайшего конкурента – автономной кассы Атол 90Ф. Нет никаких клавиатурных обозначений, комбинаций клавиш и прочего. Со Штрихом легко разберётся человек, который впервые взял в руки кассовый аппарат. Не нужно запоминать функции каждой кнопки – все действия на экране. Выбрать пункт меню при помощи клавиш навигации – подтвердить свой выбор при помощи клавиши «ОК». Всё просто.

Если в обзоре Эвотора мы сравнивали органы управления с тач-интерфейсом стандартного планшета, то Штрих можно сравнить с простым кнопочным телефоном. Да и по размеру он близок к нему. Тут уже сделан упор на людей, привыкших к тактильным ощущениям при работе с устройством. Кнопки приятные, прорезиненные, нажимаются с ощутимым «кликом», это позволяет избежать случайных нажатий. Даже в перчатках с аппаратом удобно работать, размер клавиш позволяет. На кнопки нанесены довольно контрастные обозначения. Претензий к органам управления нет, качество исполнения довольно неплохое. Но конечно хотелось бы увидеть простейшую подсветку кнопок. Лишней она тут точно не будет, особенно для курьерской службы, для которой в данном аппарате сделано очень многое. Также немного непонятным для нас явилось отсутствие кнопки промотки чековой ленты, как и на Эвоторе.

Экран цветной, диагональю 2,4 дюйма, разрешением 320*240. Вполне себе стандартные характеристики, очень близкие к характеристикам обычных кнопочных телефонов. Трудностей при чтении информации с экрана мы не испытали, всё довольно чётко и контрастно, даже на средней яркости. Тест с боковым засветом дисплей выдержал достойно – если выкрутить яркость на максимум, текст на нём остаётся читабельным. Возможность регулировки яркости является ещё одним большим плюсом в сравнении с стандартными сегментными индикаторами, которые становятся малочитабельны при малейшем боковом засвете.

Экран выполнен вровень с корпусом и защищён пластиком, эти два фактора очень затрудняют его повреждение. При должной силе удара он конечно потрескается или лопнет, но не потеряет своей работоспособности, между самим корпусом и модулем экрана есть небольшое расстояние, при бытовых повреждениях сам модуль останется цел.

Экран довольно информативен – вся информация при работе с кассой выводится на него целиком, избегая малопонятных сокращений, что являлось большой бедой сегментных индикаторов, как на 90Ф (см. обзор). Без памятки или инструкции мало кто разберётся в обозначениях, выводимых сегментами. На Штрихе опять же всё очень просто.

В верхней части устройства небольшим горбиком расположился отсек для чековой ленты. Крышка выполнена из полупрозрачного тёмного матового пластика, через него очень хорошо виден остаток ленты. Отщёлкивается с усилием, случайное открытие тут практически исключено. В нижней части отсека также находится печатающее устройство и гребёнка для ручного отрыва чека.

Печатает аппарат на 57 миллиметровой чековой ленте методом термопечати, скорость печати до 75 мм/сек. Бобина ленты размером не более 40мм в диаметре. Скорость печати не особо впечатляет, но для автономной кассы большего и не надо, ведь аппараты такого класса не рассчитаны на большой поток покупателей. Термоголовка печатает ярко и чётко, что очень важно для печати QR-кодов на чеке. Проблем с перегревом при тестовом прогоне выявлено не было.

В задней части аппарата расположились разъём USB, разъём для подключения денежного ящика, разъём Wi-Fi/GPRS антенны и гнездо для подключения зарядного устройства.

USB разъём тут служит как для подключения сканера штрих-кодов, так и для подключения USB-носителя для работы с базой товаров – аппарат умеет экспортировать и импортировать файл с перечнем номенклатуры. В данном случае нам это не совсем важно, так как вся работа с номенклатурой ведётся из облачного сервиса 1С:Касса. Но об этом мы расскажем чуть позже.

Аппарат может выходить в Интернет либо по GPRS каналу, либо при помощи подключения к Wi-Fi точке.

На нижней части устройства находится отсек для sim-карты формата miniSim. Крышка сдвигается в сторону, открывая доступ к стандартному лотку sim-карты.

Терминал работает под управлением операционной системы Linux. Оно и не удивительно – Linux сейчас используется в торговле повсеместно, начиная от терминалов сбора данных и заканчивая решениями для рабочих мест кассира. Обоснование такого выбора довольно очевидно – бесплатное распространение и открытый исходный код, позволяющий довольно гибко настраивать интерфейс и функциональные возможности. Из плюсов сюда можно отнести постоянные обновления и минимальные требования к аппаратной начинке устройства.

Интерфейс довольно прост, как мы уже и говорили выше. Всего две страницы меню, каждая из которых состоит из 9 пунктов. Минимум системных настроек – сеть, дата/время, яркость экрана и параметры ведения продажи – по свободной цене или же используя список товаров.

Более тонкие настройки производятся из программы Драйвер FR от Штриха, касса имеет возможность подключения к этой программе по интерфейсу TCP socket – при выборе соответствующего пункта меню отобразятся параметры для подключения к терминалу. Но в такие дебри при повседневном использовании лезть не придётся – настройка производится один раз при помощи компьютера и параметры записываются в память ККТ.

В целом от аппарата остались очень приятные впечатления – маленький, лёгкий, с очень понятным и простым интерфейсом. Свои недочёты тоже имеются, но они совсем не критичны.

Перейдём к самой интересной части – облачной товароучётной системе «1С:Касса».

Именно эта составляющая выгодно отличает аппарат от своих конкурентов. Ввод номенклатуры, ведение ценовой политики, анализ динамики продаж, учёт товарных остатков. Всё это сделает проще 1С:Касса. А Штрих-Мпей-Ф сделает проще сам процесс продажи.

Сервис работает на платформе 1С:Фреш, то есть доступ к нему вы можете получить из любой точки мира, нужен лишь компьютер с выходом в интернет и браузер.

Интерфейс системы максимально прост, сначала производится настройка вашей торговой точки – вводится название магазина и его адрес.

Затем на кассе генерируется специальный ключ для подключения к сервису – токен. При помощи него осуществляется привязка кассы к системе.

Далее вы просто вносите в базу данных свою номенклатуру, прямо в окне браузера. Добавляются штрих-коды, вводится наименование и устанавливается цена. Причём вы можете назначить цену просто указав закупочное значение и процент наценки. Система сама автоматически пересчитает цену продажи, учитывая процент.

Выгрузка товаров напоминает работу с терминалом сбора данных – вы формируете базу товаров и нажимаете кнопку «Выгрузить». Сервис в автоматическом режиме свяжется с кассой и, если она в сети, начнёт передачу данных. После окончания синхронизации на аппарате появится вся номенклатура, которую вы добавили в «1С:Касса». Всё что вам нужно будет сделать – начать продажу. При этом в любой момент времени вы можете изменить цены и обновить их на аппарате, прямо из своего дома, не требуя от кассира каких-либо дополнительных действий. При необходимости есть возможность ведения учёта остатков номенклатуры.

Также вам будет доступна выгрузка журнала транзакций с кассы. В товароучётной системе появится список чеков, пробитых на кассе.

Данные из этой выгрузки будут использованы для анализа динамики продаж, система сможет подсказать вам какой товар наиболее ходовой, а какой наоборот не пользуется большим спросом. Будут построены графики, сравнения и наглядные таблицы продаж. С их помощью вы всегда сможете скорректировать политику цен и политику закупки товара.

Сервис, помимо ведения перечня товаров, также поддерживает ввод перечня оказываемых услуг.

В общем система отлично дополняет и без того интересное решение от Штриха. Предприниматель видит положение своих дел как на ладони, а значит сможет быстрее принимать какие-либо важные решения.

1С:Касса будет актуальна везде – курьерская служба, небольшие кофейни, магазины у дома, рыночные павильоны. Сам аппарат простой и компактный, с достаточно широкими возможностями, а облачный сервис упрощает его наполнение номенклатурой и помогает вести учёт. И всё это за вполне приемлемые деньги.

В сравнении с Эвотором Штрих выигрывает автономностью, однако очень проигрывает по программному обеспечению – у 1С:Кассы возможностей расширения всё же пока что меньше. Но есть куда стремиться и развиваться – мы думаем, что в ближайшем будущем у облачного сервиса 1С появится множество расширений и возможностей для автоматизации. Но даже сейчас это вполне себе конкурентоспособное решение Эвотору.

Если сравнить сам аппарат с Атол 90Ф, то тут выбор очевиден. Штрих-Мпей-Ф намного проще и удобнее, пусть и дороже. На борту сразу имеется Wi-Fi и возможность подключения сканера штрих-кодов. Да и заполнение перечня товаров не идёт ни в какое сравнение с недоработанным редактором таблиц от Атол. Ну и приятным дополнением станет возможность подключения сервиса от 1С, чего нет у 90Ф.

Подключение весов ШТРИХ-ПРИНТ к 1С 8.3 Управление торговлей 11

Для подключения весов ШТРИХ-ПРИНТ ФI к 1С 8.3 Управление торговлей 11 необходимо выполнить следующие действия:
1. Настроить соединение весов с ПК одним из поддерживаемых способов (RS-232, Ethernet, Wi-Fi и т.д.)
Настройка соединения через Ethernet описана в статье «Автоматизируйте процесс фасовки и этикетирования товаров с помощью весов с печатью этикеток ШТРИХ-ПРИНТ» — на сайте AuTrade.ru
2. Подключение весов к 1С Меню Алминистрирование / РМК и оборудование.

3. Включить «Использовать подключаемое оборудование»

Тут есть небольшой нюанс. Для загрузки в торговое оборудование необходимо установить правила обмена. Но этот пункт не активен. Что пункт был доступен, нужно включить Розничные продажи.


4. Включить Розничные продажи для открытия доступа к правилам обмена с подключаемым оборудованием.

5. Включаем обмен с подключаемым оборудованием offline.

6. Создаем новое правило обмена для весов

7. Задаем максимальное количество товаров, выгружаемое в весы, и единицу измерения веса. Можно включить опцию «Выгружать изменения».

Установить необходимые фильтры и посмотреть результат т.е. посмотреть какие товары попадают в выгрузку.
8. Создаем экземпляр торгового оборудования.

Выбираем пункт «Весы с печатью этикеток» и нажимаем кнопку Создать.

Выберем Тип оборудования Весы с печатью этикеток и драйвер Штрих-М Весы с печатью этикеток. Запишем. Если правила обмена уже настроены то откроем созданный экземпляр и выберем наше настроенное правило обмена, записываем.


9. Настроим параметры соединения в 1С.

Мы в данном примере решили настраивать связь через Ethernet поэтому выбираем соответствующий интерфейс, прописываем IP-адрес, который назначен нашим весам непосредственно в самих весах (1). Далее нажимаем кнопку Функции..(2) и выбираем пункт Тест устройства. Если в окне Сообщение видим «Тест успешно выполнен» значит мы все сделали правильно и связь настроена. Далее остается перейти непосредственно к выгрузке.
10. Выгрузка в весы ШТРИХ-ПРИНТ.
Выгрузка может быть произведена вручную (3) или автоматически (4).  Обработка выгрузки находится в меню Продажи / Обмен с подключаемым оборудованием (2).

Если нужно настроить автоматический обмен (4) В окне настроек автоматического обмена нужно установить интервал обмена в минутах.

Если Вы не нашли ответов на свои вопросы в данной статье, тогда можете воспользоваться нашим форумом.

Судороги после инсульта | Stroke Association

Противоэпилептические препараты (AED)
Медикаменты обычно уменьшают судороги и позволяют вести нормальный образ жизни. Ваше лечение будет зависеть от:

  • Какие у вас припадки.
  • Ваш возраст и пол.
  • Насколько часты ваши приступы.
  • Другие последствия инсульта, например проблемы с глотанием.
  • Другие лекарства, которые вы принимаете.

Противоэпилептические препараты или противоэпилептические препараты обычно работают, изменяя уровень химических веществ в мозге.В некоторых случаях может нарушаться нормальная деятельность мозга, что приводит к сонливости, головокружению, спутанности сознания и другим побочным эффектам. Как только ваше тело привыкнет к лекарству, эти побочные эффекты могут исчезнуть. Ваш врач может начать с низкой дозы и постепенно увеличивать ее, чтобы снизить вероятность возникновения побочных эффектов. Если они тяжелые или длятся долго, ваш врач может изменить дозу или попробовать другое лекарство.

Все люди разные, и некоторые люди испытывают побочные эффекты от того или иного лекарства даже в малых дозах.Однако обычно вы можете попробовать другой тип, если это произойдет, поскольку существует множество безопасных и надежных устройств AED.

Вам могут дать одно лекарство или комбинацию двух или более. Тип, который вам назначают, зависит от типа припадков и любых побочных эффектов, которые у вас возникают от конкретного лекарства или комбинации.

Если у вас есть такие симптомы, как нестабильность, плохая концентрация внимания или рвота, ваша доза может быть слишком высокой, и вам следует обратиться к терапевту или специалисту.

Хирургия
Хирургия может быть вариантом, если противоэпилептические препараты вам не помогают, и если эпилепсия вызвана физической причиной в вашем мозгу, например рубцами или повреждением после инсульта.Возможность хирургической операции частично зависит от того, где находится проблема в вашем мозгу, и сможет ли хирург безопасно ее решить. Операция на мозге может быть очень рискованной. Вы можете поработать со своим врачом, чтобы понять риски и возможные преимущества для вас, прежде чем принимать решение.

Терапия стимуляцией блуждающего нерва
Небольшое электрическое устройство имплантируется в шею и подключается к левому блуждающему нерву. Устройство регулярно посылает в мозг электрические сигналы через блуждающий нерв, что помогает регулировать электрическую активность мозга, вызывающую эпилепсию.

Кетогенная диета
Это лечение используется для детей (а иногда и взрослых), которые не реагируют на AED. Он включает в себя диету с высоким содержанием жиров и низким содержанием углеводов. Это меняет способ использования энергии мозгом, что может уменьшить судороги. Его следует использовать только с помощью врача-специалиста и диетолога.

Стеноз внутричерепной артерии, Mayfield Brain & Spine, Цинциннати, Огайо

Обзор

Внутричерепной стеноз — это сужение артерии внутри головного мозга.Накопление бляшек (атеросклероз) внутри стенки артерии снижает приток крови к мозгу. Достаточно серьезный атеросклероз, вызывающий симптомы, сопряжен с высоким риском инсульта и может привести к повреждению мозга и смерти. Лечение направлено на снижение риска инсульта за счет контроля или удаления образования зубного налета и предотвращения образования тромбов.

Кровоснабжение головного мозга

Чтобы понять артериальный стеноз, полезно знать, как кровь циркулирует в головном мозге (см. Анатомия мозга).Кровь перекачивается из сердца и переносится в мозг двумя парными артериями, внутренними сонными артериями и позвоночными артериями (рис. 1). Внутренние сонные артерии питают передние (передние) области, а позвоночные артерии снабжают задние (задние) области мозга. Пройдя через череп, правая и левая позвоночные артерии соединяются вместе, образуя единую базилярную артерию. Базилярная артерия и внутренние сонные артерии соединяются друг с другом в кольце в основании мозга, которое называется Уиллисовым кругом.Артерии, наиболее подверженные стенозу, — это внутренняя сонная артерия (ВСА), средняя мозговая артерия (СМА), позвоночные артерии и базилярная артерия.

Рисунок 1. Внутричерепной стеноз — это сужение артерии внутри мозга из-за накопления бляшки внутри артерии. Артерии, наиболее подверженные стенозу, — это внутренняя сонная артерия, средняя мозговая артерия, позвоночные артерии и базилярная артерия.

Что такое стеноз внутричерепной артерии?

Внутричерепной стеноз — это сужение артерий внутри головного мозга.Подобно стенозу сонной артерии на шее, он вызывается накоплением налета на внутренней стенке кровеносных сосудов. Это сужение кровеносных сосудов вызывает снижение притока крови к области мозга, кровоснабжающей пораженные сосуды. Стеноз внутричерепной артерии может привести к инсульту тремя способами:

  1. Зубной налет может расти все больше и больше, сильно сужая артерию и уменьшая приток крови к мозгу. Зубной налет может в конечном итоге полностью заблокировать (закупорить) артерию.
  2. Зубной налет может сделать стенку артерии шероховатой и деформировать ее, вызывая образование тромбов и блокируя приток крови к мозгу.
  3. Зубной налет может разорваться и оторваться, перемещаясь вниз по течению, чтобы застрять в меньшей артерии и блокировать кровоток в головном мозге.

Каковы симптомы?

Симптомами стеноза внутричерепной артерии являются транзиторная ишемическая атака (ТИА) или инсульт, которые можно описать мнемоникой FAST:

F: при слабости или обвисании лица, особенно на одной стороне
A: при слабости рук или ног, покалывании или онемении, особенно на одной стороне
S: при невнятной речи
T: на время .Если у вас или у вашего близкого появятся эти симптомы, пора немедленно позвонить в службу экстренной помощи.

Симптомы ТИА и инсульта похожи. ТИА возникают, когда приток крови к мозгу временно прерывается, а затем восстанавливается. Симптомы обычно длятся пару минут, а затем полностью исчезают, и человек приходит в норму. Однако нельзя игнорировать TIA; они являются предупреждением о том, что надвигается ишемический инсульт и необратимая травма головного мозга. Если у вас или у вашего близкого появятся эти симптомы, вам следует немедленно позвонить в службу 911.

Каковы причины?

Атеросклероз — основная причина стеноза внутричерепной артерии. Оно может начаться в раннем взрослом возрасте, но симптомы могут не проявляться в течение нескольких десятилетий. У некоторых людей быстро прогрессирует атеросклероз в возрасте тридцати лет, у других — в возрасте пятидесяти или шестидесяти лет. Атеросклероз начинается с повреждения внутренней стенки артерии, вызванного высоким кровяным давлением, диабетом, курением и повышенным уровнем «плохого» холестерина. Другие факторы риска включают ожирение, сердечные заболевания, семейный анамнез и пожилой возраст.

Внутричерепной стеноз связан с несколькими состояниями, включая болезнь моямоя, радиационно-индуцированное повреждение сосудов (васкулопатия), высокое кровяное давление, высокий уровень холестерина и диабет.

Кто пострадал?

Внутричерепной стеноз является причиной от 8 до 10% инсультов в США и затрагивает одни этнические группы больше, чем другие. В эти группы входят афроамериканцы, американцы азиатского происхождения и латиноамериканцы. Пациенты с поражением внутричерепной артерии, как правило, моложе, чем пациенты с поражением сонной артерии на шее.

Как ставится диагноз?

Врач узнает как можно больше о ваших симптомах, текущих и предыдущих медицинских проблемах, текущих лекарствах и семейном анамнезе. Он или она проведет медицинский осмотр. Для обнаружения сужения внутричерепных артерий будут выполнены один или несколько диагностических визуализирующих тестов:

  • Компьютерная томографическая ангиография или КТ-ангиограмма — это неинвазивный рентгеновский снимок, который обеспечивает подробные изображения анатомических структур головного мозга.Он включает введение контрастного вещества в кровоток, чтобы можно было увидеть артерии головного мозга. Этот тип теста обеспечивает наилучшее изображение как кровеносных сосудов (с помощью ангиографии), так и мягких тканей (с помощью КТ). Это позволяет врачам увидеть суженную артерию и определить, насколько она сужена.
  • Магнитно-резонансная ангиография (МРА) аналогична КТ-ангиограмме. Контрастный краситель вводится через капельницу для освещения кровеносных сосудов шеи.
  • Ангиограмма — это минимально инвазивный тест, в котором используются рентгеновские лучи и контрастное вещество, вводимое в артерии через катетер в паху. Это позволяет врачам визуализировать все артерии и вены головного мозга. Он несет низкий риск необратимых неврологических осложнений. Помимо определения области заболевания, ангиография дает ценную информацию о степени стеноза и форме бляшки (рис. 2).
Рис. 2. Ангиограмма показывает сужение средней мозговой артерии (красные стрелки), вызванное атеросклеротической бляшкой.
  • Транскраниальный допплер Ультразвук — это быстрый и недорогой тест, используемый для измерения скорости кровотока через кровеносные сосуды головного мозга. Техники измеряют скорость кровотока, испуская высокочастотную звуковую волну от ультразвукового датчика. Разные скорости кровотока отображаются на экране компьютера разными цветами. Чем медленнее кровоток, тем выше риск инсульта.
  • Компьютерная томография (КТ) Визуализация Perfusion — это неинвазивный тест, который определяет кровоток в головном мозге и используется при планировании операции.Он включает введение контрастного вещества в кровоток, чтобы врачи: 1) могли изучить, сколько кровотока достигает головного мозга, и 2) могли определить, какие области мозга наиболее подвержены риску инсульта. Во время теста назначают лекарство под названием Диамокс (ацетазоламид) для расширения артерий. Это лекарство является разновидностью «стресс-теста» для мозга и похоже на стресс-тест, используемый для сердца.
  • Позитронно-эмиссионная томография (ПЭТ) позволяет врачу изучать функции мозга, наблюдая, как глюкоза (сахар) метаболизируется в головном мозге.Небольшое количество радиоактивной глюкозы попадает в кровоток. Сканер ПЭТ делает снимки мозга, которые интерпретируются компьютером. Результаты могут помочь врачам обнаружить аномалии.

Какие методы лечения доступны?

Целью лечения является снижение риска инсульта. Варианты лечения внутричерепного стеноза различаются в зависимости от степени сужения и наличия у вас симптомов, похожих на инсульт.Пациентам сначала назначают лекарства, и им рекомендуется изменить образ жизни, чтобы снизить риск инсульта. Хирургия ограничивается пациентами, симптомы которых не поддаются лечению.

Лекарства
Внутричерепной стеноз можно лечить с помощью лекарств, которые сводят к минимуму факторы риска, включая высокий уровень холестерина и артериальное давление. Если вы курите, вам могут назначить лекарства, которые помогут вам бросить курить. Пациентам с диабетом будет рекомендовано строго контролировать уровень сахара в крови с помощью здоровой диеты и тщательного наблюдения.

  • Разжижитель крови лекарства, также называемые антикоагулянтами (аспирин, плавикс, кумадин), позволяют крови легче проходить через суженные артерии и предотвращают свертывание крови. Исследования показывают, что аспирин и кумадин обладают схожими преимуществами. Поскольку антикоагулянты связаны с повышенным риском кровотечения, пациенты могут контролироваться на предмет аномального кровотечения. Аспирин имеет меньше побочных эффектов, чем кумадин, и связан с меньшим риском кровотечения или кровотечения [1].У пациентов, принимающих кумадин, необходимо периодически контролировать кровь; Пациентам, принимающим аспирин и / или Плавикс, наблюдение не требуется.
  • Препараты , снижающие уровень холестерина, помогают уменьшить образование дополнительных бляшек при атеросклерозе. Эти лекарства могут снизить уровень холестерина ЛПНП (липопротеинов низкой плотности) в среднем на 25–30% в сочетании с диетой с низким содержанием жиров и холестерина.
  • Артериальное давление лекарства (диуретики, ингибиторы АПФ, блокаторы ангиотензина, бета-блокаторы, блокаторы кальциевых каналов и т. Д.)) помогают контролировать и регулировать кровяное давление. Поскольку высокое кровяное давление является основным фактором риска инсульта, рекомендуется регулярно проверять кровяное давление и регулярно принимать лекарства.

Хирургия
Целью хирургического вмешательства является предотвращение инсульта путем удаления или уменьшения образования бляшек и расширения артерии для обеспечения большего притока крови к мозгу. Хирургическое лечение рассматривается для пациентов, симптомы которых не поддаются лечению.Например, у тех, кто продолжает страдать от ТИА или инсульта, у пациентов со стенозом высокой степени и у тех, у кого недостаточное кровоснабжение определенной области мозга.

  • Баллонная ангиопластика / стентирование — это минимально инвазивная эндоваскулярная процедура, при которой происходит сжатие бляшки и увеличение диаметра артерии (рис. 3). Эндоваскулярное лечение означает, что процедура проводится внутри артерии, из кровотока, с помощью небольшого гибкого катетера.Катетер вводят в бедренную артерию в паху во время ангиограммы. Затем катетер продвигается по кровотоку к месту, где расположена артерия, суженная бляшкой. Затем в суженную артерию медленно надувается небольшой баллон, чтобы расширить ее и прижать бляшку к стенке артерии. Рис. 3. Во время ангиопластики катетер с баллонным наконечником помещается в суженный сосуд. Баллон надувается, сжимая бляшку и открывая артерию. После удаления баллона над бляшкой помещают саморасширяющуюся сетчатую трубку, называемую стентом, чтобы удерживать артерию открытой.Стент остается в артерии навсегда.

    Цель состоит в том, чтобы уменьшить стеноз менее чем на 50%, поскольку небольшое увеличение диаметра сосуда приводит к значительному увеличению притока крови к мозгу. Затем баллон сдувается и удаляется. В некоторых случаях саморасширяющаяся сетчатая трубка, называемая стентом, помещается поверх бляшки, удерживая артерию открытой. Осложнения после ангиопластики могут включать инсульт, разрыв стенки сосуда от катетера или баллона и спазм сосудов.

    Ангиопластика обычно рекомендуется пациентам со стенозом артерий высокой степени (более 70%) и рецидивирующими симптомами ТИА или инсульта, несмотря на медикаментозное лечение [2].Ангиопластика / стентирование может успешно уменьшить стеноз до менее 30% без осложнений у 60–80% пациентов [3].

  • Шунтирование мозговой артерии — это хирургическая процедура, которая направляет кровоток вокруг области, заблокированной бляшками. Для этой процедуры необходимо сделать отверстие в черепе, что называется трепанацией черепа. Донорская артерия от черепа отделяется от своего нормального положения на одном конце, перенаправляется внутрь черепа и соединяется с артерией на поверхности мозга.Артерия черепа теперь поставляет кровь в мозг и обходит заблокированный сосуд (см. Хирургия шунтирования мозга). Осложнения шунтирования могут включать инсульт, спазм сосудов и тромбообразование в донорском сосуде.

    Шунтирование обычно рекомендуется, когда артерия заблокирована на 100% и ангиопластика невозможна. Результаты обходного анастомоза сильно различаются в зависимости от места и типа обходного анастомоза. Спросите своего хирурга, каких результатов вы можете ожидать.

Клинические испытания
Клинические испытания — это научные исследования, в которых новые методы лечения — лекарства, диагностика, процедуры и другие методы лечения — тестируются на людях, чтобы убедиться, что они безопасны и эффективны.Постоянно проводятся исследования по повышению уровня медицинского обслуживания. Информацию о текущих клинических испытаниях, включая право на участие, протокол и места проведения, можно найти в Интернете. Исследования могут спонсироваться Национальными институтами здравоохранения (см. Clinicaltrials.gov), а также частными промышленными и фармацевтическими компаниями (см. Centerwatch.com).

Восстановление и профилактика

Несмотря на лечение лекарствами, пациенты, перенесшие инсульт или ТИА из-за стеноза внутричерепной артерии, сталкиваются с риском повторного инсульта от 12 до 14% в течение 2-летнего периода после первоначального инсульта.В некоторых группах высокого риска годовой риск повторного инсульта может превышать 20% [4].

После ангиопластики рестеноз может возникать у 7,5–32,4% пациентов и обычно не имеет симптомов. Долгосрочный результат профилактики инсульта после ангиопластики еще не известен, но краткосрочные результаты многообещающие и в настоящее время изучаются в клинических испытаниях.

Важно понимать, что атеросклероз — прогрессирующее заболевание. Чтобы предотвратить инсульт, ваш врач может попросить вас бросить курить, ограничить употребление алкоголя, поддерживать хороший контроль уровня сахара в крови (если у вас диабет), снизить уровень холестерина и принимать лекарства в соответствии с предписаниями.

Источники и ссылки

Если у вас есть дополнительные вопросы, свяжитесь с Mayfield Brain & Spine по телефону 800-325-7787 или 513-221-1100.

Источники

  1. Chimowitz MI, et al. Сравнение варфарина и аспирина при симптоматическом стенозе внутричерепных артерий. N Engl J Med 352 (13): 1305-16, 2005
  2. Meyers PM и др.: Показания для выполнения внутричерепных эндоваскулярных нейроинтервенционных процедур: научное заявление.Тираж 119: 2235–2249, 2009 г.
  3. Рингер А.Дж., Абруццо Т. и др. Ангиопластика и стентирование для лечения внутричерепного стеноза. In, Геморрагический и ишемический инсульт: хирургические, интервенционные, визуальные и медицинские подходы. Нью-Йорк, Тим, 2010
  4. Куреши А.И. и др. Консенсус-конференция по внутричерепному атеросклеротическому заболеванию: обоснование, методология и результаты. J Neuroimaging 19 Suppl 1: 1S-10S, 2009.

Ссылки
StrokeAssociation.org

Stroke.org

ангиопластика: эндоваскулярная процедура с использованием катетера с баллонным наконечником для увеличения сужения артерии.

атеросклероз: заболевание артериальных кровеносных сосудов, при котором стенки артерий утолщаются и становятся твердыми бляшками. Бляшки состоят из холестерина и других липидов, воспалительных клеток и отложений кальция; также называется «затвердеванием артерий».”

ишемический инсульт: инсульт, вызванный прерыванием или блокировкой притока богатой кислородом крови к определенной области мозга; вызвано сгустком крови, атеросклерозом, спазмом сосудов или пониженным кровяным давлением.

Холестерин ЛПНП: Холестерин липопротеинов низкой плотности является первичной молекулой холестерина. Высокий уровень ЛПНП, прозванного «плохим» холестерином, увеличивает риск атеросклероза.

стент : трубчатое устройство, которое вставляется в сосуд или проход, чтобы держать его открытым.

транзиторная ишемическая атака (ТИА): «мини-инсульт», вызванный, когда приток крови к мозгу временно прерывается, а затем восстанавливается; не вызывает необратимого повреждения мозга.

вазоспазм : аномальное сужение или сужение артерий из-за раздражения стенки сосуда или кровью в субарахноидальном пространстве.


обновлено> 4.2018
рассмотрено> Эндрю Рингер, доктор медицины, клиника Мэйфилд, Цинциннати, Огайо

Сертифицированная медицинская информация Mayfield материалов написаны и разработаны клиникой Mayfield Clinic.Мы соблюдаем стандарт HONcode в отношении достоверной информации о здоровье. Эта информация не предназначена для замены медицинских рекомендаций вашего поставщика медицинских услуг.

транзиторных ишемических атак: Часть II. Лечение

1. Мурадян М.С., Маджумдар SR, Сентилсельван А, Хан К, Шуайб А. Насколько хорошо справляются с гипертонией, гиперлипидемией, диабетом и курением после инсульта или транзиторной ишемической атаки? Инсульт .2002; 33: 1656–9 ….

2. Sudlow C, Губиц Г, Сандеркок П., Губа Г. Профилактика инсульта. Clin Evid . 2003; (9): 221–45.

3. Альберс GW, Харт Р.Г., Луцеп ХЛ, Ньюэлл Д.В., Sacco RL. Научное заявление AHA. Дополнение к руководству по ведению транзиторных ишемических атак: заявление Специального комитета по транзиторным ишемическим атакам, Совет по инсульту, Американская кардиологическая ассоциация. Инсульт . 1999; 30: 2502–11.

4. Чобанян А.В., Бакрис Г.Л., Черный HR, Cushman WC, Зеленый L A, Иззо JL младший, и другие. Седьмой отчет Объединенного национального комитета по профилактике, выявлению, оценке и лечению высокого кровяного давления: отчет JNC 7 [опубликованное исправление опубликовано в JAMA 2003; 290: 197]. JAMA . 2003; 289: 2560–72.

5. Semplicini A, Мареска А, Boscolo G, Сартори М, Рокки Р., Гигантин V, и другие.Гипертония при остром ишемическом инсульте: компенсаторный механизм или дополнительный повреждающий фактор ?. Arch Intern Med . 2003. 163: 211–6.

6. Юсуф С, Sleight P, Пог J, Bosch J, Дэвис Р, Дагене Г. Влияние ингибитора ангиотензин-превращающего фермента рамиприла на сердечно-сосудистые события у пациентов из группы высокого риска. Исследователи оценочного исследования профилактики сердечных исходов [опубликованное исправление опубликовано в N Engl J Med 2000; 342: 1376]. N Engl J Med . 2000; 342: 145–53.

7. Коллективная группа «ПРОГРЕСС». Рандомизированное испытание схемы снижения артериального давления на основе периндоприла среди 6 105 человек, перенесших инсульт или преходящую ишемическую атаку [опубликованные исправления представлены в Lancet 2001; 358: 1556 и Lancet 2002; 359: 2120]. Ланцет . 2001; 358: 1033–41.

8. Hankey GJ. Ингибиторы ангиотензинпревращающего фермента для профилактики инсульта: есть ли НАДЕЖДА на ПРОГРЕСС после ЖИЗНИ ?. Инсульт . 2003. 34: 354–6.

9. Доннан Г.А., Дэвис С.М., Бережливость А. Роль снижения артериального давления до и после инсульта. Текущее мнение Neurol . 2003. 16: 81–6.

10. Шинтон Р., Биверс Г. Мета-анализ связи между курением сигарет и инсультом. BMJ . 1999; 298: 789–94.

11. Вторичная профилактика неревматической фибрилляции предсердий после транзиторной ишемической атаки или малого инсульта.EAFT (Европейское исследование фибрилляции предсердий) Исследовательская группа. Ланцет . 1993; 342: 1255–62.

12. Элкинс Ю.С., Сидни С, Гресс ДР, Идти КАК, Бернштейн А.Л., Johnston SC. Электрокардиографические данные позволяют прогнозировать краткосрочную сердечную заболеваемость после транзиторной ишемической атаки. Arch Neurol . 2002; 59: 1437–41.

13. Iso H, Джейкобс Д.Р. Младший, Вентворт Д., Neaton JD, Коэн JD. Уровни холестерина в сыворотке и шестилетняя смертность от инсульта у 350 977 мужчин, прошедших скрининг для участия в испытании по вмешательству множественных факторов риска. N Engl J Med . 1989; 320: 904–10.

14. Рандомизированное исследование снижения уровня холестерина у 4444 пациентов с ишемической болезнью сердца: Скандинавское исследование выживаемости симвастатина (4S). Ланцет . 1994; 344: 1383–9.

15. Плен Дж. Ф., Дэвис Б.Р., Мешки FM, Rouleau JL, Пфеффер М.А., Бернштейн V, и другие. Снижение частоты инсульта после инфаркта миокарда с помощью правастатина: исследование холестерина и повторяющихся событий (CARE). The CARE Investigators Circulation . 1999; 99: 216–23.

16. Гольдштейн Л. Б., Адамс Р, Беккер К, Фурберг CD, Горелик ПБ, Хадеменос G, и другие. Первичная профилактика ишемического инсульта: заявление для медицинских работников от Совета по инсульту Американской кардиологической ассоциации. Тираж . 2001; 103: 163–82.

17. Пирсон Т.А., Блэр С.Н., Дэниэлс С.Р., Экель Р. Х., Ярмарка JM, Фортманн СП, и другие.Рекомендации AHA по первичной профилактике сердечно-сосудистых заболеваний и инсульта: обновление 2002 г .: руководство консенсусной группы по всестороннему снижению риска для взрослых пациентов без коронарных или других атеросклеротических сосудистых заболеваний. Научный консультативный и координационный комитет Американской кардиологической ассоциации. Тираж . 2002; 106: 388–91.

18. Манктелов Б, Гиллис С, Поттер Дж. Ф. Вмешательства в управление липидами сыворотки для предотвращения рецидива инсульта. Кокрановская база данных Syst Rev . 2004; (1): CD002091.

19. Бурчфил К.М., Бордюр JD, Родригес Б.Л., Эбботт РД, Чиу Д, Яно К. Непереносимость глюкозы и частота инсульта в 22 года. Сердечная программа Гонолулу. Инсульт . 1994; 25: 951–7.

20. Ретинопатия и нефропатия у пациентов с сахарным диабетом 1 типа через четыре года после интенсивной терапии. Исследовательская группа по контролю диабета и его осложнениям / эпидемиологии вмешательств и осложнений диабета [опубликованное исправление опубликовано в N Engl J Med 2000; 342: 1376]. N Engl J Med . 2000; 342: 381–9.

21. Straus SE, Маджумдар SR, Макалистер Ф.А. Новые данные о профилактике инсульта: научный обзор. JAMA . 2002; 288: 1388–95.

22. Влияние рамиприла на сердечно-сосудистые и микрососудистые исходы у людей с сахарным диабетом: результаты исследования HOPE и дополнительного исследования MICRO-HOPE. Исследователи оценочного исследования профилактики сердечных исходов [опубликованное исправление опубликовано в Lancet 2000; 356: 860]. Ланцет . 2000; 355: 253–9.

23. Gerstein HC. Снижение сердечно-сосудистых событий и микрососудистых осложнений при диабете с помощью лечения ингибиторами АПФ: НАДЕЖДА и МИКРО-НАДЕЖДА. Diabetes Metab Res. Ред. . 2002; 18приложение 3: S82–5.

24. Сандеркок П., Мильке О, Лю М, Советник К. Антикоагулянты для предотвращения рецидива после предполагаемого некардиоэмболического ишемического инсульта или транзиторной ишемической атаки. Кокрановская база данных Syst Rev .2004; (1): CD000248.

25. Berge E, Сандеркок П. Антикоагулянты в сравнении с антиагрегантами при остром ишемическом инсульте. Кокрановская база данных Syst Rev . 2004; (1): CD003242.

26. Сотрудничество исследователей антитромботических препаратов. Совместный метаанализ рандомизированных испытаний антитромбоцитарной терапии для предотвращения смерти, инфаркта миокарда и инсульта у пациентов с высоким риском [опубликованная поправка появилась в BMJ 2002; 324: 141]. BMJ .2002. 324: 71–86.

27. Bennett CL, Коннорс Дж. М., Carwile JM, Моак Дж. Л., Белл WR, Тарантоло SR, и другие. Тромботическая тромбоцитопеническая пурпура, ассоциированная с клопидогрелом. N Engl J Med . 2000; 342: 1773–7.

28. Рандомизированное слепое исследование клопидогреля по сравнению с аспирином у пациентов с риском ишемических событий (CAPRIE). Руководящий комитет CAPRIE. Ланцет . 1996, 348: 1329–39.

29. Diener HC, Cunha L, Forbes C, Сивениус Дж, Смец П, Ловенталь А. Европейское исследование профилактики инсульта. 2. Дипиридамол и ацетилсалициловая кислота во вторичной профилактике инсульта. Дж. Neurol Sci . 1996; 143: 1–13.

30. Вольф П.А., Clagett GP, Истон JD, Гольдштейн Л.Б., Горелик ПБ, Келли-Хейс М, и другие. Профилактика ишемического инсульта у пациентов, перенесших инсульт и преходящую ишемическую атаку: заявление для медицинских работников от Совета по инсульту Американской кардиологической ассоциации. Инсульт . 1999; 30: 1991–4.

31. Wilterdink JL, Истон Д. Дипиридамол плюс аспирин при цереброваскулярных заболеваниях. Arch Neurol . 1999; 56: 1087–92.

32. Хэнки Г.Дж., Warlow CP. Лечение и вторичная профилактика инсульта: доказательства, затраты и влияние на людей и группы населения. Ланцет . 1999; 354: 1457–63.

33. Благоприятный эффект каротидной эндартерэктомии у симптомных пациентов со стенозом сонной артерии высокой степени.Североамериканские участники исследования симптоматической каротидной эндартерэктомии. N Engl J Med . 1991; 325: 445–53.

34. Barnett HJ, Тейлор Д.В., Элиашив М, Фокс Эй Джей, Фергюсон Г.Г., Хейнс РБ, и другие. Преимущества каротидной эндартерэктомии у пациентов с симптоматическим стенозом средней или тяжелой степени. Североамериканские участники исследования симптоматической каротидной эндартерэктомии. N Engl J Med . 1998; 339: 1415–25.

35.Инзитари Д, Элиашив М, Ворота P, Шарп Б.Л., Чан РК, Мелдрам ХЭ, и другие. Причины и риск инсульта у пациентов с бессимптомным стенозом внутренней сонной артерии. Североамериканские участники исследования симптоматической каротидной эндартерэктомии. N Engl J Med . 2000; 342: 1693–700.

36. Биллер Дж., Файнберг В.М., Кастальдо Дж. Э., Виттемор А.Д., Харбо RE, Демпси Р.Дж., и другие.Рекомендации по каротидной эндартерэктомии: заявление для специалистов в области здравоохранения Специальной письменной группы Совета по инсульту Американской кардиологической ассоциации. Тираж . 1998. 97: 501–509.

37. Беттманн М.А., Катцен БТ, Whisnant J, Брант-Завадски М, Бродерик JP, Фурлан А.Дж., и другие. Стентирование сонной артерии и ангиопластика: заявление для медицинских работников от Советов по сердечно-сосудистой радиологии, инсульту, сердечно-торакальной и сосудистой хирургии, эпидемиологии и профилактике, а также клинической кардиологии Американской кардиологической ассоциации. Инсульт . 1998. 29: 336–8.

38. Koudstaal PJ. Антикоагулянты в сравнении с антитромбоцитарной терапией для предотвращения инсульта у пациентов с неревматической фибрилляцией предсердий и инсультом или транзиторными ишемическими атаками в анамнезе. Кокрановская база данных Syst Rev . 2004; (1): CD000187

39. Hart RG, Паласио S, Пирс Л.А. Фибрилляция предсердий, инсульт и острая антитромботическая терапия: анализ рандомизированных клинических исследований. Инсульт .2002; 33: 2722–7.

40. Кардиогенная эмболия головного мозга. Второй отчет Целевой группы по церебральной эмболии [опубликованное исправление опубликовано в Arch Neurol 1989; 46: 1079]. Arch Neurol . 1989; 46: 727–43.

41. Эванс А, Перес I, Ю Г, Калра Л. Вторичная профилактика инсульта при фибрилляции предсердий: уроки клинической практики. Инсульт . 2000. 31: 2106–11.

42. Fuster V, Райден Л.Е., Асингер RW, Cannom DS, Crijns HJ, Фрай Р.Л., и другие.Рекомендации ACC / AHA / ESC по ведению пациентов с фибрилляцией предсердий: краткое содержание. Отчет рабочей группы Американского колледжа кардиологов / Американской кардиологической ассоциации по практическим рекомендациям и Комитета кардиологов Европейского общества по практическим рекомендациям и политическим конференциям (Комитет по разработке рекомендаций по ведению пациентов с фибрилляцией предсердий в сотрудничестве с Североамериканским обществом кардиостимуляции и электрофизиологии). Тираж .2001; 104: 2118–50.

43. Albers GW, Дален Дж. Э., Лаупасис А, Мэннинг WJ, Петерсен П., Певица Д.Е. Антитромботическая терапия при фибрилляции предсердий. Сундук . 2001; 1191 приложение 1: 194С – 206С.

44. Viscoli CM, Латунь LM, Кернан WN, Саррель П.М., Суисса С, Horwitz RI. Клиническое испытание заместительной эстрогеновой терапии после ишемического инсульта. N Engl J Med . 2001; 345: 1243–9.

45. Мэнсон Дж. Э., Ся Дж, Джонсон KC, Россоу Дж. Э., Ассаф АР, Лассер Н.Л., и другие., Исследователи Инициативы по охране здоровья женщин. Эстроген плюс прогестин и риск ишемической болезни сердца. N Engl J Med . 2003. 349: 523–34.

46. Wassertheil-Smoller S, Хендрикс С.Л., Лимахер М, Heiss G, Куперберг С, Бэрд А, и другие. Влияние эстрогена и прогестина на инсульт у женщин в постменопаузе: Инициатива по охране здоровья женщин: рандомизированное исследование. JAMA . 2003. 289: 2673–84.

47. Гиллум Л.А., Мамидипуди СК, Johnston SC. Риск ишемического инсульта при применении оральных контрацептивов: метаанализ. JAMA . 2000. 284: 72–8.

48. Coull BM, Уильямс Л.С., Гольдштейн Л.Б., Меския JF, Хайцман Д., Чатурведи С, и другие. Антикоагулянты и антиагреганты при остром ишемическом инсульте: отчет Объединенного комитета по разработке рекомендаций по инсульту Американской академии неврологии и Американской ассоциации инсульта (подразделение Американской кардиологической ассоциации). Инсульт . 2002; 33: 1934–42.

49. Хирш Дж., Дален Дж, Гайатт Дж., Американский колледж грудных врачей. Шестое (2000 г.) руководство ACCP по антитромботической терапии для профилактики и лечения тромбозов. Американский колледж грудных врачей. Сундук . 2001; 1191 доп: 1С – 307С.

50. Лечение табакокурения и зависимости. Руководство по клинической практике. Роквилл, штат Мэриленд: Департамент здравоохранения и социальных служб США, Служба общественного здравоохранения, июнь 2000 г.По состоянию на 15 января 2004 г., http://www.surgeongeneral.gov/tobacco/treating_tobacco_use.pdf.

51. Вульф Ш., Дэвидсон МБ, Зеленые поля, Белл HS, Ганац Т.Г., Хаген MD, и другие. Контроль уровня глюкозы в крови у пациентов с сахарным диабетом 2 типа. Политическое заявление, основанное на фактах, Американской академии семейных врачей и Американской диабетической ассоциации. J Fam Pract . 2000; 49: 453–60.

52.Fuster V, Ryden LE, Asinger RW, Cannm DS, Crijas HJ, Frye RL и др. Американская ассоциация клинических эндокринологов. Медицинские рекомендации AACE по клинической практике диагностики и лечения дислипидемии и профилактики атерогенеза. Endocr Pract 2000; 6: 162–213. По состоянию на 15 января 2004 г., http://www.aace.com/clin/guidelines/lipids.pdf.

53. Горелик ПБ, Сакко Р.Л., Смит ДБ, Альбертс М, Мустон-Александр Л, Райдер D, и другие.Профилактика первого инсульта: обзор руководящих принципов и многопрофильное консенсусное заявление Национальной ассоциации инсульта. JAMA . 1999; 281: 1112–20.

54. Schünemann H, ed. Краткое справочное руководство для клиницистов на Шестой консенсусной конференции ACCP по антитромботической терапии. По состоянию на 14 января 2004 г., по адресу http://www.chestnet.org/downloads/guidelines/antithrombotic/qrg.pdf.

55. Hack W, Kaste M, Богоуславский Ж, Брайнин М, Чаморро А, Лис К., и другие., Исполнительный комитет Европейской инициативы по инсульту и Письменный комитет EUSI. Рекомендации Европейской инициативы по борьбе с инсультом — обновление 2003 г. Cerebrovasc Dis . 2003. 16: 311–37.

56. Сакко Р.Л. Клиническая практика. Стеноз экстракраниальной сонной артерии. N Engl J Med . 2001; 345: 1113–8.

Экспрессия матричной металлопротеиназы-9 усиливается за счет ишемии и тканевого активатора плазминогена и вызывает кровотечение, инвалидность и смертность при экспериментальном инсульте

Матричная металлопротеиназа-9 (ММР-9) разрушает коллаген и другие белки клеточного матрикса.После острого ишемического инсульта повышение уровня MMP-9 коррелирует с кровотечением, недостаточной реперфузией и тяжестью инсульта. Тем не менее окончательных данных о том, что ММП-9 сама по себе вызывает плохие исходы при ишемическом инсульте, ограничено. На модели экспериментального ишемического инсульта с реперфузией мы исследовали, влияет ли ишемия и терапия рекомбинантным тканевым активатором плазминогена (r-tPA) на экспрессию MMP-9, и мы использовали специфические ингибиторы, чтобы проверить, влияет ли MMP-9 на повреждение и восстановление мозга. После инсульта экспрессия ММР-9 значительно увеличилась при ишемии vs.неишемическое полушарие головного мозга ( p <0,001). Экспрессия MMP-9 в ишемическом, но не в неишемическом полушарии дополнительно увеличивалась обработкой r-tPA ( p <0,001). Чтобы определить, влияет ли экспрессия MMP-9 на исход инсульта после лечения r-tPA, мы протестировали три различных ингибитора антитела MMP-9. По сравнению с лечением r-tPA и физиологическим раствором, лечение r-tPA и ингибиторами антител MMP-9 значительно уменьшило кровоизлияние в мозг на 11.От 3 до 38,6 раза ( p <0,01), отек мозга в 2,8-4,3 раза ( p <0,001) и инфаркт мозга в 2,5-3,9 раза ( p <0,0001). Аналогичным образом, по сравнению с лечением r-tPA и физиологическим раствором, лечение r-tPA и ингибитором антител MMP-9 значительно улучшило нейроповеденческие исходы ( p <0,001), уменьшило потерю веса ( p <0,001) и увеличило выживаемость. ( p <0,01). Таким образом, как длительная ишемия, так и r-tPA избирательно усиливали экспрессию MMP-9 в ишемическом полушарии.При введении с r-tPA специфические ингибиторы MMP-9 заметно снижали кровоизлияние в мозг, отек, инфаркт, инвалидность и смерть, что позволяет предположить, что блокирование пагубных эффектов MMP-9 может улучшить исходы после ишемического инсульта.

Последовательная активация некроптоза и апоптоза способствует развитию сосудистой и нервной патологии при инсульте

Инсульт является ведущей причиной смерти и серьезной долгосрочной инвалидности во всем мире. Большое количество исследований показало, что множественная гибель клеток и провоспалительные пути опосредуют неврологические повреждения при этом разрушительном заболевании (1).Однако мы до сих пор не понимаем механизмов, которые способствуют активации и взаимодействию между различными путями гибели клеток при инсульте. Некроптоз и апоптоз — это два регулируемых механизма гибели клеток, которые участвуют в опосредовании неврологического повреждения при инсульте (2, 3). Некроптоз, форма регулируемого некроза, был впервые продемонстрирован при разработке и применении низкомолекулярного ингибитора некростатина-1 (Nec-1 / Nec-1s) в отсутствие его механизма нацеливания (2).Было обнаружено, что Nec-1s является высокоспецифичным ингибитором киназы RIPK1 (4). Было показано, что активация RIPK1 опосредует два альтернативных механизма гибели клеток в зависимости от способности клетки к апоптозу: некроптоз в условиях дефицита апоптоза и апоптоз в условиях отсутствия апоптоза (5). Стимуляция клеток TNFα с ингибированием каспаз способствует активации RIPK1 и его взаимодействию с RIPK3, что, в свою очередь, фосфорилирует MLKL (псевдокиназу, подобную домену киназы смешанного происхождения), чтобы опосредовать выполнение некроптоза (6, 7).В условиях, благоприятных для апоптоза, стимуляция TNFα может привести к активации активности киназы RIPK1, чтобы способствовать RIPK1-зависимому апоптозу (RDA), опосредуя образование комплекса IIa с FADD и каспазой-8 (8, 9). Неясно, как клетки умирают от некроптоза или апоптоза in vivo без искусственного ингибирования каспаз.

TAK1 (кодируется геном MAP3K7) является ключевым медиатором множества внутриклеточных сигнальных путей (10). В клетках, стимулированных TNFα, TAK1 опосредует фосфорилирование комплекса IKK, способствуя активации пути NF-κB.TAK1 также контролирует активацию RIPK1, поскольку потеря TAK1 очень эффективна для сенсибилизации клеток к RDA (11). Было показано, что подавление уровней TAK1 в стареющем мозге человека обеспечивает основной механизм, который способствует возникновению бокового амиотрофического склероза / лобно-височной деменции у людей с наследственной гаплонедостаточностью TBK1 (12).

Хотя было показано, что апоптоз переходит в некроптоз при ингибировании каспаз (2, 7), неясно, может ли некроптоз также переходить в апоптоз, и если да, то какие условия могут опосредовать этот переход.Здесь мы исследовали активацию некроптоза и апоптоза в головном мозге мышей, подвергшихся временной окклюзии средней мозговой артерии (MCAO), модели инсульта у людей. Мы обнаружили активированный RIPK1 (p-S166 RIPK1) в микроглии / инфильтрированных макрофагах, нейронах и церебральных эндотелиальных клетках в головном мозге после ишемического инсульта. Некроптоз быстро активировался в эндотелиальных клетках после временного ишемического инсульта в начале реперфузии, чтобы опосредовать сосудистое повреждение, тогда как нейроны демонстрировали раннюю активацию некроптоза с последующим апоптозом, вызванным снижением уровня TAK1.Избирательная потеря TAK1 в микроглии / инфильтрированных макрофагах и нейронах способствовала апоптотической гибели нейрональных клеток и воспалению. Наконец, генетическое ингибирование киназы RIPK1 уменьшало ишемический инфаркт за счет блокирования как некроптоза, так и RDA и ослабления нейровоспаления, тогда как блокирование только некроптоза за счет дефицита RIPK3 уменьшало кровоизлияние в мозг и объем долгосрочного ишемического инфаркта.

Результаты

Генетическое и фармакологическое ингибирование RIPK1 снижает ишемическое повреждение головного мозга.

Для изучения механизмов гибели клеток при инсульте у мышей дикого типа (WT) Ripk1 D138N / D138N мышей, несущих аллель мертвого нокина D138N киназы RIPK1, и Ripk3 905 — — — мышей подвергали временной MCAO, мышиной модели инсульта, с 60-минутной окклюзией с последующими 23-часовой реперфузией (2). Степень церебрального инфаркта измеряли через 24 часа после начала MCAO. Ударный объем у мышей Ripk1 D138N / D138N , но не у мышей Ripk3 — / — , был значительно снижен по сравнению с мышами WT при анализе через 24 часа после MCAO (рис.1 A и B ).

Рис. 1.

Активация RIPK1 при ишемическом инсульте. ( A ) WT, Ripk1 D138N / D138N и Ripk3 — / — мышей подвергали временной 60-минутной MCAO с последующей реперфузией. Мышей умерщвляли через 23 часа реперфузии, и мозг обрабатывали для окрашивания ТТС для измерения объема инфаркта ( n = 27 на группу). ( B ) Типичное окрашивание ТТС у мышей, подвергшихся 60-минутной ишемии с последующими 23-часовой реперфузией.( C ) Количественная оценка геморрагических поражений путем количественного определения гемоглобина у WT, Ripk1 D138N / D138N и Ripk3 — / — мышей, обработанных A 902 ( D ) WT, Ripk1 D138N / D138N и Ripk3 — / — мышей подвергали временной 60-минутной MCAO с последующей реперфузией и оценивали с помощью шкалы Гарсия. двойным слепым методом ежедневно с 1 по 4 день после процедуры MCAO ( n = 12 на группу).Наивысший балл составляет 21 балл, и более высокий балл коррелирует с лучшим результатом. ( E ) Лизаты мозга мышей с указанными генотипами, подвергнутых MCAO в течение 60 мин с последующей реперфузией в течение указанных периодов времени, иммунопреципитировали p-S166 RIPK1 и затем анализировали иммуноблоттингом с указанными антителами. ( F H , верхний ) Срезы WT, Ripk1 D138N / D138N и Ripk3 — / — minperfusion с последующим повторным введением мышей MC в течение 23 часов ( F и H ) или 3 часа ( G ) и в разные моменты времени, как указано на гистограммах, иммуноокрашивали p-S166 RIPK1 и коиммуноокрашивали с помощью IBA1, CD31 или NeuN для IBA1 + микроглия / инфильтрованные макрофаги ( F ), цереброваскулярные эндотелиальные клетки ( G ) и нейроны ( H ) соответственно.(Увеличение: 40 ×; полоса продажи: 50 мкм.) ( F H , Нижний ) Количественная оценка результатов. Данные представляют собой среднее значение ± стандартная ошибка среднего. n = 3 мыши для каждой временной точки. Оценка каждой временной точки включает данные из пяти разделов примерно для 150 клеток в каждой мыши. ( F ) Большой квадрат Вставки ( Правый ) — это увеличенные изображения малого квадрата Вставки ( Левый ). * P <0,05, ** P <0.01 и *** P <0,001.

Внутримозговое кровоизлияние — один из наиболее распространенных типов инсульта у людей (13). Соответственно, мы проанализировали, влияет ли блокирование некроптоза на геморрагическую трансформацию в модели MCAO. Мы обнаружили, что частота геморрагической трансформации, вызванной MCAO, была значительно ниже у мышей Ripk1 D138N / D13N8 и Ripk3 — / — мышей по сравнению с контрольными мышами WT (рис.1 C и рис. S1 A ). Объем инсульта был меньше у мышей Ripk1 D138N / D13N8 и Ripk3 — / — мышей по сравнению с мышами WT на 4-й день после MCAO, что может включать эффект инфильтрации иммунных клеток в конце моменты времени ( SI Приложение , рис. S1 B ). Улучшение показателей поведения было больше у мышей Ripk1 D138N / D13N8 и Ripk3 — / — мышей по сравнению с мышами WT (рис.1 D ). Эти результаты предполагают, что некроптоз важен для опосредования сосудистой патологии, способствующей ишемическому инфаркту, и что активация RIPK1 может опосредовать вредные события, помимо активации некроптоза, управляемого RIPK3. Таким образом, ингибирование RIPK1 может быть более эффективным, чем дефицит RIPK3 в защите от ишемического инфаркта мозга.

Чтобы изучить взаимодействие RIPK1 и RIPK3 в опосредовании ишемического повреждения головного мозга, мы оценили активацию RIPK1 после ишемического инсульта с помощью иммуноблоттинга с использованием p-S166 RIPK1, биомаркера активации RIPK1 (12, 14).Мы обнаружили, что RIPK1 быстро активировался через 1 час после начала реперфузии у мышей WT, а активация RIPK1 блокировалась у мышей Ripk1 D138N / D13N8 , но не у мышей Ripk3 — / — мышей (рис.1 E ). Этот результат предполагает, что RIPK1 активируется выше RIPK3 после ишемического инсульта.

Затем мы охарактеризовали типы клеток с активированным RIPK1 после индукции MCAO путем иммуноокрашивания. Сигнал p-S166 RIPK1 был обнаружен в микроглии IBA1 + / инфильтрированных макрофагах, эндотелиальных клетках и нейронах в области полутени коры у мышей WT, подвергнутых MCAO.Иммуноокрашивание p-S166 RIPK1 показало различные временные изменения в этих трех типах клеток: эндотелиальные клетки CD31 + и микроглия / инфильтрованные макрофаги IBA1 + показали пик p-S166 RIPK1 + через 2 часа после реперфузии, тогда как NeuN + нейроны начали показывать p-S166 RIPK1 + через ~ 2-5 часов после реперфузии с пиком примерно через 23 часа (рис. 1 F H ). Увеличение p-S166 RIPK1 + было полностью заблокировано генетическим ингибированием RIPK1 у мышей Ripk1 D138N / D138N , в то время как потеря RIPK3 у Ripk3

— / — 902 мышей эффекта не оказала. об активации РИПК1.

Мы также выполнили иммуноокрашивание для оценки общих уровней RIPK1 на срезах мозга ложнооперированных мышей и мышей MCAO. В искусственно оперированном мозге мышей сигналы RIPK1 обнаруживались преимущественно в микроглии IBA1 + и эндотелиальных клетках CD31 + ( SI Приложение , рис. S2 A ). После индукции MCAO в WT или Ripk3 — / — животных, мы обнаружили повышенный RIPK1 + IBA1 + микроглии / инфильтрованные макрофаги, RIPK1 + CD31 + эндотелиальные клетки + NeuN + нейронов ( SI Приложение , рис.S2 C и D ). Интересно отметить, что уровни мРНК или белка Ripk1 не увеличивались в мозге мышей WT в ходе ишемического инсульта, а также Ripk1 D138N / D138N или Ripk3 — / — — / — эффект ( SI Приложение , рис. S2 E и F ). Таким образом, очевидное увеличение количества клеток RIPK1 + , обнаруженное в головном мозге после ишемического инсульта, вероятно, связано с конформационными изменениями в RIPK1 во время его активации.

В совокупности эти результаты демонстрируют, что киназная активность RIPK1 стимулируется церебральным ишемическим инсультом. Кроме того, они показывают, что генетическое или фармакологическое ингибирование киназы RIPK1 может снизить ударный объем, и хотя потеря RIPK3 не влияет на активацию RIPK1, блокирование некроптоза с помощью Ripk3 — / — может снизить риск внутримозгового кровоизлияния и ударного объема при ударе. более поздние временные точки.

Активация некроптоза и апоптоза после ишемического инсульта.

Поскольку активность киназы RIPK1 активируется при церебральном ишемическом инсульте головного мозга, мы затем исследовали два основных нижестоящих пути гибели клеток, опосредованные активированным RIPK1: некроптоз и RDA. Некроптоз может быть активирован в условиях дефицита апоптоза. При некроптозе активированный RIPK1 взаимодействует с RIPK3, способствуя его активации, которая маркируется p-T231 / S232 RIPK3. Активированный RIPK3, в свою очередь, фосфорилирует MLKL, маркированный p-S345 MLKL, чтобы опосредовать выполнение некроптоза (7, 15–17).Активированные RIPK3 и MLKL проявляют дифференциальную растворимость по сравнению с контрольным состоянием и концентрируются в нерастворимой 6 М фракции мочевины Nonidet P-40 (14, 18). При иммуноблот-анализе лизатов мозга мышей WT после ишемического инсульта p-T231 / S232 RIPK3 и p-S345 MLKL были обнаружены сразу после реперфузии и оставались повышенными до ~ 5 ч после начала реперфузии (фиг. 2 A ). Реперфузия после ишемической окклюзии важна для активации некроптоза, поскольку p-MLKL не был обнаружен в ишемизированном мозге без реперфузии (модель инсульта с постоянной окклюзией) (рис.2 B и C ). Помимо некроптоза, расщепление каспазы-3, биомаркера апоптоза, также было обнаружено в ишемическом мозге, достигая пика через 24 часа после ишемического инсульта (рис. 2 A ).

Рис. 2.

Активация некроптоза и апоптоза ишемическим инсультом. ( A ) Лизаты мозга мышей WT, получавших MCAO в течение 60 минут с последующей реперфузией в течение указанных периодов времени, анализировали иммуноблоттингом на p-S345 MLKL, MLKL, p-T231 / S232 RIPK3, RIPK3, CC3 и тубулин. .( B ) Лизаты мозга мышей WT, получавших постоянную окклюзию в течение указанных периодов времени, анализировали иммуноблоттингом на p-S345 MLKL, MLKL и тубулин. ( C ) Лизаты мозга, полученные в 6 M мочевины от мышей WT, обработанных MCAO в течение 60 минут с последующей реперфузией в течение 0, 1, 2 или 5 часов или без реперфузии, анализировали иммуноблоттингом на p-S345 MLKL и MLKL. ( D E , Upper ) Срезы головного мозга WT, Ripk1 D138N / D138N и Ripk3 — / — после повторной обработки мышей MCAO в течение 60 минут в течение 3 ч иммуноокрашивали на p-T231 / S232 RIPK3 ( D ) и p-S345 MLKL ( E ) и коиммуноокрашивали с CD31.Количественно оценивали эндотелиальные клетки P-RIPK3 + в разные моменты времени (, нижний ). ( F H ) Срезы головного мозга мышей WT, Ripk1 D138N / D138N и Ripk3 — / — мышей, обработанных MCAO в течение 60 минут с последующей реперфузией иммуноокрашенный на p-T231 / S232 RIPK3 ( F ), p-S345 MLKL ( G ) или CC3 ( H ) и коиммуноокрашенный с NeuN. ( D H , Нижний ) P-RIPK3 + , p-MLKL + и CC3 + нейроны или эндотелиальные клетки, указанные в разные моменты времени, были определены количественно.Данные представляют собой среднее значение ± стандартная ошибка среднего; n = 3 мыши на момент времени. (Увеличение: 40 ×; шкала: 50 мкм.) Оценка каждой временной точки включает данные из пяти секций для приблизительно 150 клеток от каждой мыши. * P <0,05, ** P <0,01 и *** P <0,001.

Мы также проанализировали p-S345 MLKL и p-T231 / S232 RIPK3 с помощью иммуноокрашивания. Как p-S345 MLKL, так и p-T231 / S232 RIPK3 оказались коиммуноокрашенными с эндотелиальными клетками CD31 + в течение 2 часов после начала реперфузии в области полутени коры (рис.2 D и E ). Это предполагает, что значительная часть гибели некроптозных клеток, происходящая после ишемического инсульта мозга, приходится на эндотелиальные клетки.

Мы также обнаружили p-S345 MLKL и p-T231 / S232 RIPK3 в нейронах после MCAO (рис. 2 F и G ). Помимо признаков некроптоза, мы также обнаружили значительную часть нейронов NeuN + , которые расщепили каспазу-3 + (CC3 + ), что происходило с задержкой по сравнению с некроптозом (рис.2 H ). Таким образом, церебральный ишемический инсульт у мышей WT запускает некроптоз в эндотелиальных клетках сразу после начала реперфузии, что способствует внутримозговому кровоизлиянию, в то время как нейроны могут подвергаться как некроптозу, так и апоптозу.

MCAO-индуцированные сигналы p-T231 / S232 RIPK3 и p-S345 MLKL были подавлены в обоих Ripk1 D138N / D138N и Ripk3 — / —
мыши (Рис. — G ).Напротив, расщепление каспазы-3 подавлялось только у мышей Ripk1 D138N / D138N , но не у мышей Ripk3 — / — (рис. 2 H ). Это говорит о том, что церебральный ишемический инсульт также вызывает RDA.

Поскольку церебральное воспаление играет важную роль в исходе инсульта (19), а некроптоз и RDA способствуют воспалению (20), мы далее охарактеризовали влияние ингибирования киназы RIPK1 и потери RIPK3 на IBA1 + микроглия / инфильтрованные макрофаги. , основные медиаторы нейровоспаления.Мы охарактеризовали количество и морфологию микроглии / инфильтрированных макрофагов в головном мозге WT, Ripk1 D138N / D138N , и Ripk3 — / — через разное время после инсульта. наступление реперфузии. Мы не наблюдали значительной разницы в количестве микроглии / инфильтрированных макрофагов между тремя группами; однако микроглиоз с активированной амебоидоподобной микроглией / инфильтрированными макрофагами был подавлен в мозге Ripk1 D138N / D138N , , но не Ripk3 — / — 902 , Рисунок.S3 A C ).

Мы также использовали количественную ОТ-ПЦР для измерения экспрессии мРНК провоспалительных цитокинов и хемокинов в мозге MCAO-индуцированного WT, Ripk1 D138N / D138N , и Ripk193 мышей в разные моменты времени после начала реперфузии. Мы наблюдали снижение уровней провоспалительных цитокинов и хемокинов, включая TNFα, IL6, IL1α, IL1β и Cxcl1, в мозге мышей Ripk1 D138N / D138N во время реперфузии после ишемического инсульта (рис.3). Напротив, характер экспрессии провоспалительных цитокинов и хемокинов в мозге мышей Ripk3 — / — был аналогичен таковому у мышей WT с небольшим снижением в 23-часовой временной точке. Эти результаты предполагают, что воспалительный ответ, опосредованный киназой RIPK1, активируется рано после ишемического инсульта, в то время как некроптоз, опосредованный RIPK3, также может вносить вклад в воспаление с задержкой во времени.

Рис. 3.

Ингибирование RIPK1 блокирует нейровоспаление, вызванное церебральным ишемическим инсультом.Количественный анализ ОТ-ПЦР уровней экспрессии мРНК указанных цитокинов и хемокинов в лизатах головного мозга от WT, Ripk1 D138N / D138N и Ripk3 — / — для мышей, обработанных MC мин с последующей реперфузией в течение указанных периодов времени ( n = 5 мышей для каждой временной точки). Данные представляют собой среднее значение ± стандартная ошибка среднего. * P <0,05.

В совокупности приведенные выше результаты демонстрируют, что некроптоз быстро активируется в эндотелиальных клетках и нейронах после церебральной ишемии-реперфузии, в то время как RDA индуцируется в нейронах замедленным образом, достигая пика примерно через 24 часа после ишемического инсульта и реперфузии.Поскольку киназа RIPK1 участвует в опосредовании некроптоза, RDA и воспаления, ингибирование киназы RIPK1 может блокировать гибель эндотелиальных клеток и нейронов, а также продукцию провоспалительных цитокинов и хемокинов, в то время как блокирование некроптоза может лишь частично спасти гибель и амплификацию клеток. воспалительной реакции после начала реперфузии.

Снижение TAK1 после ишемического инсульта.

Затем мы исследовали механизмы, способствующие апоптозу во время реперфузии после ишемического инсульта.Поскольку TAK1 является важным негативным регулятором RDA (11), мы оценили, участвовала ли потеря TAK1-опосредованного подавления, исследуя уровни его экспрессии в мозге мышей WT во время реперфузии после ишемического инсульта. Интересно, что мы обнаружили, что уровни TAK1 начали снижаться во время реперфузии примерно через 2 часа после ишемического инсульта (рис. 4 A ). Фосфорилирование Thr180 / Thy182 p38 и Thy183 / Tyr185 JNK, нижележащих субстратов TAK1, также снижалось во время реперфузии примерно в тот же период времени, тогда как фосфорилирование Thr202 / Thr204 ERK не показало разницы.Аналогичное снижение уровня белка TAK1 наблюдалось в головном мозге мышей WT, Ripk1 D138N / D138N , и Ripk3 — / — мышей во время реперфузии (рис. 4 В ). Таким образом, потеря TAK1, вероятно, будет происходить в восходящем направлении и не зависит от RIPK1 и RIPK3.

Рис. 4.

Снижение TAK1 в нейронах и микроглии / инфильтрированных макрофагах, вызванное гипоперфузией головного мозга. ( A ) Лизаты головного мозга мышей WT, получавших MCAO в течение 60 минут с последующей реперфузией в течение указанных периодов времени, анализировали иммуноблоттингом на TAK1, p- (T180 / Y182) p38, p38, p-T183 / Y185 JNK, JNK. , p-T202 / Y204 ERK и ERK с тубулином в качестве контроля нагрузки.( B ) Лизаты мозга мышей с указанными генотипами, подвергнутых MCAO в течение 60 минут с последующей реперфузией в течение указанных периодов времени, анализировали иммуноблоттингом на TAK1 и тубулин в качестве контроля нагрузки. Те же данные WT Ripk1 + / + в A использовали в B для сравнения с данными мутантных мышей. ( C и D , верхний ) Срезы мозга мышей WT, подвергнутых MCAO в течение 60 минут с последующей реперфузией в течение 23 часов, иммуноокрашивали TAK1 и коиммуноокрашивали IBA1 ( C ) и NeuN ( D ) .Ядра окрашивали красителем Hoechst. Количественная оценка TAK1 + / IBA1 + микроглии / инфильтрированных макрофагов и TAK1 + / NeuN + нейронов показаны в нижней части каждой панели. n = 3 мыши. Количественные оценки включают около 100 клеток TAK1 + и около 100 клеток CC3 + от каждой мыши. Четвертые панели в каждом столбце представляют собой увеличенные изображения вставок . (Масштабная шкала, белая: 100 мкм; увеличение: 20 ×.) (Масштабная шкала, желтая: 50 мкм; увеличение: 40 ×.) ( E , Left ) Клетки TAK1 + / CC3 + через 24 ч после MCAO количественно определяли двойным иммуноокрашиванием на TAK1 и CC3. n = 3 мыши. ( E , справа ) Количественные оценки включали ~ 100 ячеек. Данные представляют собой среднее значение ± стандартная ошибка среднего. Четвертые панели в каждом столбце представляют собой увеличенные изображения вставок . (Масштаб, белый: 100 мкм; увеличение: 20 ×.) (Масштаб, желтый: 50 мкм; увеличение: 40 ×.) ( F I ) Первичная микроглия ( F и H ) и нейроны ( G и I ) мышей WT обрабатывали депривацией сыворотки в присутствии MG132 (10 мкМ), E64d (5 мкг / мл), Velcade (50 нг / мл), хлорохина (50 мкг / мл). мл) или комбинацию, указанную в течение 18 часов.Лизаты анализировали иммуноблоттингом на TAK1, RIPK1 и тубулин. ( J ) Окрашивание ТТС мышей со снижением rCBF> 80% ( слева, ) и <80% снижением rCBF ( справа, ). Лизаты головного мозга мышей WT, получавших лечение без операции, фиктивная операция, MCAO с уменьшением rCBF> 80% и MCAO с уменьшением rCBF <80% с последующей реперфузией в течение 23 часов, анализировали с помощью иммуноблоттинга на TAK1 и тубулин в качестве контроля нагрузки. * P <0,05, ** P <0.01 и *** P <0,001.

Мы также оценили типы клеток, которые показали снижение экспрессии TAK1 в головном мозге мышей WT с помощью иммуноокрашивания. В искусственно оперированном головном мозге дикого типа TAK1 экспрессировался как в микроглии / инфильтрированных макрофагах IBA1 + , так и в нейронах NeuN + . Уровни TAK1 были снижены как в микроглии / инфильтрированных макрофагах, так и в нейронах через 23 часа реперфузии после ишемического инсульта (фиг. 4 C и D ). В соответствии с подавлением апоптоза с помощью TAK1, мы обнаружили, что присутствие активированного CC3 + в значительной степени исключено из клеток, которые были положительными по экспрессии TAK1 (рис.4 E ). Никакого снижения мРНК MAP3K7 не было обнаружено после ишемического инсульта и реперфузии у животных WT, Ripk1 D138N / D138N или Ripk3 — / — животных, что позволяет предположить, что потеря экспрессии TAK1 маловероятна. результат снижения транскрипции ( SI Приложение , рис. S4).

Ранее мы сообщали о снижении экспрессии TAK1 в стареющем мозге человека (12), а также было показано, что старение приводит к снижению перфузии кровью тканей и органов (21).Таким образом, мы рассмотрели, может ли гипоперфузия быть общим фактором, способствующим снижению уровней TAK1 при инсульте и старении мозга. Действительно, мы обнаружили, что удаление сыворотки снижает уровни TAK1 в культивируемых первичной микроглии и нейронах (фиг. 4 F и G ). Ингибирование протеасомной и лизосомальной деградации одновременно, но не по отдельности, блокировало снижение TAK1 из нейронов и микроглии в условиях удаления сыворотки, предполагая, что может происходить как лизосомная, так и протеасомная деградация TAK1 (рис.4 H и I ). Точно так же удаление сыворотки из культивируемых эмбриональных фибробластов мыши (MEF) также снижает уровни TAK1, что может быть устранено путем блокирования как протеасомной, так и лизосомной деградации MG132 / E64d или Velcade / E64d ( SI Приложение , Рис. S5 A и B ). Уровни мРНК MAP3K7 были даже немного увеличены в MEF при удалении сыворотки, подтверждая, что снижение TAK1 не опосредовано изменениями транскрипции ( SI Приложение , рис.S5 C ). Напротив, уровни общего RIPK1 не изменялись при отмене сыворотки, что согласуется с предположением, что изменения TAK1 находятся выше RIPK1.

Чтобы изучить эффекты гипоперфузии in vivo, мы проанализировали мозг мышей, у которых была индуцирована MCAO, но региональный мозговой кровоток (rCBF) был снижен на <80%, что было недостаточно для индукции инсульта. Интересно, что снижение уровней TAK1 было обнаружено в мозге этих мышей, у которых не было инфаркта (рис.4 Дж ). Таким образом, даже небольшое снижение rCBF может привести к снижению TAK1 in vivo, что может служить полезной парадигмой для понимания снижения TAK1 в стареющем мозге. Эти результаты предполагают, что снижения перфузии крови в мозге после инсульта достаточно для снижения уровней TAK1, способствуя его деградации.

Снижение TAK1 способствует апоптозу после ишемического инсульта головного мозга.

Чтобы понять функциональное значение снижения TAK1 в ишемическом мозге, мы выборочно снизили экспрессию TAK1 в миелоидных или нейрональных клонах путем создания условного MAP3K7 fl / fl ; Lyz2 cre / + или MAP3K7 fl / fl ; Emx cre / + мышей соответственно.Мы подтвердили делецию TAK1 у этих мышей с условным нокаутом ( SI Приложение , фиг. S6 A ). Снижение TAK1 миелоидной или нейрональной линии привело к увеличению ударного объема по сравнению с таковым у мышей WT (фиг. 5 A ). Мы оценили влияние снижения TAK1 на активацию RIPK1 после ишемического инсульта с помощью иммуноблоттинга p-S166 RIPK1 и обнаружили, что p-S166 RIPK1 увеличивался и сохранялся дольше после MCAO в MAP3K7 fl / fl ; Lyz2 cre / + или MAP3K7 fl / fl ; Emx cre / + мышей по сравнению с мышами WT (рис.5 В ). Сигнал p-S166 RIPK1 оставался обнаруживаемым в MAP3K7 fl / fl ; Emx cre / + мышей через 4 дня после MCAO, когда он был ниже предела обнаружения у мышей WT.

Рис. 5.

Избирательная потеря TAK1 усиливает активацию RIPK1, способствуя апоптозу. ( A ) WT, MAP3K7 эт. / Эт ; Lyz2 cre / + и MAP3K7 fl / fl ; Emx cre / + мышей (каждая точка представляет 1 мышь) подвергали временной 60-минутной MCAO с последующей реперфузией в течение 23 часов.Мозг обрабатывали для окрашивания ТТС для измерения объема инфаркта. ( B ) Лизаты мозга мышей с указанными генотипами, подвергнутых MCAO в течение 60 мин с последующей реперфузией в течение указанных периодов времени, иммунопреципитировали p-S166 RIPK1 и анализировали иммуноблоттингом с указанным антителом. ( C E , верхний ) Отрезки WT, MAP3K7 fl / fl ; Lyz2 cre / + и MAP3K7 fl / fl ; Emx cre / + мыши, получавшие кратковременную 60-минутную MCAO с последующей реперфузией в течение 5 часов ( C и E ) или 3 часа ( D ) в разные моменты времени, как указано на столбце графики были иммуноокрашены p-S166 RIPK1 и коиммуноокрашены IBA1, CD31 или NeuN для микроглии / инфильтрированных макрофагов ( C ), цереброваскулярных эндотелиальных клеток ( D ) и нейронов ( E ) соответственно.Большие вставки ( справа ) в C представляют собой увеличенное изображение меньших вставок ( слева ). (Увеличение: 40 ×; шкала: 50 мкм.) ( C E , Lower ) Количественная оценка результатов. Данные представляют собой среднее значение ± стандартная ошибка среднего. Количественное определение p-S166 Ripk1 + микроглии / инфильтрированных макрофагов, эндотелиальных клеток и нейронов показано внизу каждой панели. n = 3 мыши для каждой временной точки.Оценка каждой временной точки включает данные из пяти разделов примерно для 150 клеток в каждой мыши. * P <0,05 и ** P <0,01.

Затем мы провели иммуноокрашивание p-S166 RIPK1 в головном мозге WT, MAP3K7 fl / fl ; Lyz2 cre / + , и MAP3K7 fl / fl ; Emx cre / + мышей после MCAO. Процент p-S166 RIPK1 + IBA1 + микроглии / инфильтрированных макрофагов был выше в MAP3K7 fl / fl ; Lyz2 cre / + мышей по сравнению с WT или MAP3K7 fl / fl ; Emx cre / + мышей через 2-5 ч после реперфузии (рис.5 С ). Эндотелиальные клетки CD31 + показали сходное процентное содержание клеток p-S166 RIPK1 + у всех трех типов мышей (фиг. 5 D ). MAP3K7 эт. / Эт. ; Lyz2 cre / + мыши имели более высокий процент нейронов p-S166 RIPK1 + NeuN + через 2–5 ч после реперфузии по сравнению с WT и MAP3K7 fl / fl Emx cre / + мыши; а MAP3K7 эт / эт ; Emx cre / + мыши имели более высокий процент нейронов p-S166 RIPK1 + на 4-й день (рис.5 E ). Эти результаты предполагают, что дефицит TAK1 способствует активации RIPK1 как в микроглии / инфильтрированных макрофагах, так и в нейронах с разными временными курсами.

Затем мы проанализировали последствия дефицита ТАК1 на индукцию апоптоза после церебрального ишемического инсульта. В MAP3K7 фл / фл ; Lyz2 cre / + у мышей CC3, опосредованный церебральной ишемией, возник раньше, чем у мышей WT, и выявлялся уже через 2 часа после начала реперфузии; кроме того, пик CC3 был раньше, чем у мышей WT (рис.6 A и B ). Это предполагает, что апоптоз нейронов может быть индуцирован TAK1-дефицитной микроглией / инфильтрированными макрофагами не клеточно-автономным образом. Этот побочный эффект микроглии / инфильтрированных макрофагов, вероятно, опосредован производством цитокинов и хемокинов, поскольку уровни провоспалительных цитокинов, таких как TNFα и IL6, были выше в мозге MAP3K7 fl / fl ; Lyz2 cre / + мышей относительно мышей WT через 5 ч после реперфузии (рис.6 С ).

Рис. 6.

Избирательная потеря TAK1 из микроглии / инфильтрированных макрофагов или нейронов способствует апоптозу. ( A ) Лизаты мозга мышей с указанными генотипами, реперфузированными в течение указанных периодов после 60 мин MCAO, анализировали иммуноблоттингом на CC3 и тубулин. ( B , Upper ) Срезы мозга WT, MAP3K7 fl / fl ; Lyz2 cre / + и MAP3K7 fl / fl ; Emx cre / + Мышей, получавших MCAO в течение 60 минут с последующей реперфузией в течение 23 часов, иммуноокрашивали на CC3.( B , Lower ) Количественные данные CC3 + нейронов показаны внизу. n = 3 мыши для каждой временной точки. Данные представляют собой среднее значение ± стандартная ошибка среднего. Оценка каждой временной точки включает данные из пяти разделов примерно для 150 клеток в каждой мыши. (Увеличение: 40 ×; шкала: 50 мкм.) ( C ) Количественный анализ RT-PCR экспрессии мРНК указанных цитокинов и хемокинов в мозге WT, MAP3K7 fl / fl ; Lyz2 cre / + и MAP3K7 fl / fl ; Emx cre / + мышей, подвергнутых 60 мин MCAO с последующей реперфузией в разные периоды времени. n = 4 мыши на момент времени. Данные представляют собой среднее значение ± стандартная ошибка среднего. ( D ) MAP3K7 эт / эт ; Lyz2 cre / + Мышей подвергали 60 мин MCAO, а затем вводили только носитель или Nec-1 (20 мг / кг) внутрибрюшинно. через 0 часов и 17 часов после начала MCAO. Лизаты головного мозга из MAP3K7 fl / fl ; Lyz2 cre / + мышей, реперфузированных в течение 23 часов после 60-минутной окклюзии, анализировали с помощью иммуноблоттинга на CC3 и тубулин.( E ) MAP3K7 эт. ; Emx cre / + Мышей подвергали 60 мин MCAO, а затем вводили только носитель или Nec-1 (20 мг / кг) внутрибрюшинно. через 0 часов и 17 часов после начала MCAO. Лизаты головного мозга из MAP3K7 fl / fl ; Emx cre / + мышей, реперфузированных в течение 23 часов после 60 минут окклюзии, анализировали иммуноблоттингом на CC3 и тубулин. * P <0.05, ** P <0,01 и *** P <0,001.

In MAP3K7 fl / fl ; Emx cre / + мышей начало CC3 не изменилось по сравнению с таковым у мышей WT; однако максимальный CC3 произошел раньше и в большей степени по сравнению с WT, и CC3 все еще обнаруживался в MAP3K7 fl / fl ; Emx cre / + мышей, но не у мышей WT, через 4 дня после ишемического инсульта (рис.6 В ).

Потеря TAK1 либо из миелоидного, либо из нейронального клонов не оказывала значительного влияния на активацию некроптоза, индуцированного церебральной ишемией, как измерено уровнями p-MLKL в лизатах головного мозга из обоих MAP3K7 fl / fl ; Lyz2 cre / + мыши и MAP3K7 fl / fl ; Emx cre / + мышей, подвергшихся MCAO ( SI Приложение , рис.S6 B F ).

Помимо повышенных уровней апоптоза, мы обнаружили значительное увеличение уровней провоспалительных цитокинов и хемокинов как в MAP3K7, , , , ни в флаконе ; Lyz2 cre / + мыши и MAP3K7 fl / fl ; Emx cre / + мышей, подвергнутых MCAO (фиг. 6 C ). В MAP3K7 фл / фл ; Lyz2 cre / + мышей, получавших MCAO, уровни провоспалительных цитокинов были выше, чем у мышей WT через 5 ч после реперфузии, тогда как у MAP3K7 fl / fl ; Emx cre / + мышей, уровни провоспалительных цитокинов в этот ранний период были такими же, как у дикого типа.Однако с 24 ч до 4-го дня после реперфузии MAP3K7 фл / фл ; Emx cre / + мыши показали повышенные уровни провоспалительных цитокинов, предполагая, что устойчивый апоптоз после потери TAK1 из нейронов также может способствовать выработке провоспалительных сигналов.

Чтобы исследовать, зависит ли активация апоптоза при потере TAK1 от функции киназы RIPK1, мы ввели специфический ингибитор киназы RIPK1, Nec-1s, в оба: MAP3K7 fl / fl ; Lyz2 cre / + мыши и MAP3K7 fl / fl ; Emx cre / + мышей, подвергшихся MCAO.Введение Nec-1 подавляло расщепление каспазы-3 у обоих типов мышей (фиг. 6 D и E ).

В совокупности эти находки подтверждают, что сниженная экспрессия TAK1 в микроглии / инфильтрированных макрофагах способствует продукции провоспалительных цитокинов, которые, в свою очередь, активируют апоптоз нейронов не-клеточно-автономно. Кроме того, избирательная потеря TAK1 из нейронов увеличивает апоптоз как по величине, так и по времени, а также продукцию провоспалительных цитокинов.Взятые вместе, эти результаты предполагают, что снижение TAK1 в постишемическом мозге способствует апоптозу и нейровоспалению.

Обсуждение

В этом исследовании мы изучили временную и интерактивную взаимосвязь между некроптозом и апоптозом после ишемического инсульта головного мозга и обнаружили, что некроптоз быстро активируется после церебрального ишемического инсульта в зависимости от реперфузии. Основываясь на биомаркерах некроптоза, p-RIPK3 и p-MLKL, некроптоз, вызванный ишемическим инсультом, происходит в основном в церебральных эндотелиальных клетках и нейронах, тогда как апоптоз происходит в основном в нейронах с задержкой по времени.Активированная микроглия / инфильтрированные макрофаги после ишемического инсульта показывают p-RIPK1, что подтверждает роль RIPK1 в опосредовании нейровоспаления (20). Мы показываем, что некроптоз церебральных эндотелиальных клеток опосредует внутримозговое кровоизлияние. Поскольку нейроны подвергаются как некроптозу, так и RDA, ингибирование киназы RIPK1 мутацией D138N и Nec-1, которые могут блокировать как некроптоз, так и RDA, снижает ударный объем, в то время как ингибирование некроптоза Ripk3 — / — спасает церебральное кровоизлияние и воспаление, что приводит к уменьшению ишемического ударного объема только в более поздние сроки.Эти результаты предполагают, что активация RIPK1 является одним из основных вредных механизмов в головном мозге после ишемического инсульта. Последствия активации RIPK1 проявляют специфичность клеточного типа: активация RIPK1 в эндотелиальных клетках способствует некроптозу и микрососудистому повреждению мозга, активация RIPK1 в нейронах способствует как некроптозу, так и апоптозу в различные моменты времени, в то время как активация RIPK1 в микроглии / инфильтрированных макрофагах способствует воспалению.Поскольку экспрессия TNFR1 и TNFR2 в нейронах очень низкая в нормальных условиях (22, 23), наше исследование также предполагает возможность того, что активация RIPK1 в нейронах после церебральной ишемии может происходить независимо от передачи сигналов TNFα, что поднимает вопрос о том, как RIPK1 может активируется независимо от TNFR1, что является устоявшейся парадигмой, в которой RIPK1 играет важную роль в опосредовании вредных сигнальных ответов.

Было показано, что интрацеребровентрикулярное введение Nec-1 снижает объем инфаркта в MCAO с расширенным временным окном для нейрозащиты (2).Последующие исследования подтвердили защитный эффект ингибирования киназы RIPK1 при ишемических повреждениях, индуцированных в нескольких тканях / органах, включая мозг, глаза, сердце и почки (24–31). В то время как эти исследования подчеркнули важную роль RIPK1 как центрального медиатора повреждения мозга после острого ишемического повреждения нейронов, остается неясным, как активация RIPK1 опосредует повреждения тканей и гибель клеток. Здесь мы показываем, что активация RIPK1 имеет решающее значение для опосредования как апоптоза, так и некроптоза после ишемического повреждения, тогда как RIPK3-опосредованный некроптоз в первую очередь опосредует патологию сосудов и долгосрочный ударный объем.Потеря TAK1 после снижения церебральной перфузии повышает чувствительность к апоптозу и переходу от некроптоза к RDA.

Наше исследование демонстрирует, что механизм перехода от некроптоза к апоптозу in vivo опосредуется снижением TAK1 за счет гипоперфузии. Апоптоз можно переключить на некроптоз при ингибировании каспаз (2, 7), но переключение с некроптоза на апоптоз не было показано. Мы обнаружили, что снижение TAK1 способствует апоптозу после активации некроптоза, вызванного гипоперфузией.Наши результаты предполагают, что снижение TAK1 в стареющем мозге человека (12) также может быть связано с гипоперфузией головного мозга. Условная потеря TAK1, в частности, из клеток миелоидной линии, включая микроглию и макрофаги, в MAP3K7 фл / фл ; Lyz2 cre / + мышей ускоряет начало апоптоза после ишемического инсульта головного мозга. Поскольку активированная каспаза-3 присутствует в основном в нейронах мышей WT, подвергнутых MCAO, эти результаты предполагают, что потеря TAK1 может ускорить начало апоптоза нейронов не-клеточно-автономно.Кроме того, поскольку нейрон-специфическая потеря TAK1 в MAP3K7 фл / фл ; Emx cre / + мыши могут способствовать размеру и устойчивости апоптоза, этот результат предполагает, что потеря TAK1 может также способствовать клеточно-автономному апоптозу нейронов. Таким образом, наши данные свидетельствуют о том, что уровень TAK1 служит критическим фактором для определения уязвимости ЦНС после ишемического инсульта. В связи с этим сниженные уровни TAK1 в стареющем мозге человека (12) могут предрасполагать пожилых людей к когнитивным нарушениям, опосредованным в первую очередь RDA после ишемического инсульта, тогда как у более молодых людей инсульт может активировать в первую очередь некроптоз, а затем RDA.Это может служить будущим направлением для этой работы.

Было высказано предположение, что активация протеасомных и лизосомальных протеаз опосредует ишемическое повреждение головного мозга (32–34). Повышенные уровни конъюгатов убиквитин-белок наблюдаются после церебральной ишемии, что согласуется с активацией протеасомной деградации (35). Было показано, что модуляция убиквитин-протеасомной системы, например, путем введения протеасомных ингибиторов, улучшает неврологические исходы после церебральной ишемии (36).Здесь мы показываем, что активация как протеасомной, так и лизосомальной деградации в условиях ишемии участвует в опосредовании деградации TAK1 для повышения чувствительности к апоптозу, и, таким образом, снижение уровней TAK1 может обеспечивать молекулярный механизм, который связывает активацию протеасомной и лизосомальной систем в условиях ишемии. условия возникновения апоптоза.

Роль киназы RIPK1 в опосредовании как кровоизлияния в мозг, так и гибели нейрональных клеток при инсульте предполагает эффективность ингибиторов RIPK1 при лечении как геморрагического, так и ишемического инсульта.Тканевый активатор плазминогена и механическая тромбэктомия, одобренные варианты лечения острого ишемического инсульта, имеют внутричерепное кровоизлияние как частое нежелательное явление и поэтому не подходят для пациентов с геморрагической трансформацией. Современная парадигма лечения требует дифференциальной диагностики инсульта с ишемической трансформацией и инсультом с геморрагической трансформацией, что приводит к задержкам в начале лечения и ухудшению результатов для пациентов. Наши результаты показывают, что ингибирование RIPK1 может снизить как геморрагическую трансформацию, так и гибель нейрональных клеток, что может позволить использовать терапевтические средства, нацеленные на RIPK1, без дифференциальной диагностики.Учитывая большое терапевтическое окно ингибирования RIPK1 (до 6 часов) (2, 3), это может предоставить важную возможность уменьшить потерю неврологической функции у пациентов с инсультом. Мы демонстрируем, что активация некроптоза зависит от реперфузии и активируется сразу после ишемического инсульта при реперфузии. Эндотелиальные клетки, составляющие гематоэнцефалический барьер (ГЭБ), необходимый для поддержания нормальной функции мозга, очень чувствительны к нарушениям в ишемических условиях (37). Таким образом, введение ингибитора RIPK1 после инсульта может предоставить возможность уменьшить повреждение ГЭБ, а также защитить неврологическую функцию путем ингибирования как некроптоза, так и апоптоза.

Методы

Животные.

Мышей Lyz2Cre / Cre и мышей EmxCre / Cre были приобретены в лаборатории Джексона (складские номера 004781 и 005628). Все животные содержались в среде, свободной от патогенов, и эксперименты проводились в соответствии с протоколами, утвержденными Комитетом по уходу и использованию животных Гарвардской медицинской школы. Мыши Ripk3 — / — были подарком компании Vishva Dixit, Genentech. Мыши MAP3K7 fl / fl были подарком Dr.Шизуо Акира, Университет Осаки.

Генотипирование мышей. Для генотипирования

Tak1 (f / f) использовали следующие праймеры (5 ‘> 3’): обратный: GGAACCCGTGGATAAGTGCACTTGAAT; вперед: GGCTTTCATTGTGGAGGTAAGCTGAGA. Для генотипирования Lyz2Cre использовали следующие праймеры (5 ‘> 3’): общие: CTTGGGCTGCCAGAATTTCTC; WT вперед: TTACAGTCGGCCAGGCTGAC; мутант вперед: CCCAGAAATGCCAGATTACG. Для генотипирования EmxCre использовали следующие праймеры (5 ‘> 3’): WT вперед: AAG GTG TGG TTC CAG AAT CG; мутант вперед: GCG GTC TGG CAG TAA AAA CTA TC; WT реверс: CTC TCC ACC AGA AGG CTG AG; обратный мутант: GTG AAA CAG CAT TGC TGT CAC TT.Другие протоколы генотипирования мышей следовали опубликованной литературе.

Индукция MCAO.

Эксперименты на животных проводились в соответствии с инструкциями STAIR и в соответствии с нашими институциональными руководящими принципами и согласно протоколу на животных, утвержденному Комитетом по уходу и использованию животных Гарвардской медицинской школы. Все мыши находились на фоне C57BL / 6. Мышей C57BL / 6 (от 23 до 28 г, от 7 до 9 недель) анестезировали 3% изофлураном и поддерживали 1,2% изофлураном в 70% закиси азота и 30% кислорода.rCBF контролировали с помощью лазерного допплера (Perimed), снабженного гибким зондом. Ректальную температуру поддерживали от 36,5 ° C до 37,5 ° C с помощью гомеотермического одеяла. Обнажена и отсечена правая общая сонная артерия. После перевязки крылонебной артерии открыли внутреннюю сонную артерию и наложили временный зажим, чтобы прервать обратный ток крови из головного мозга. Через разрезанную внешнюю сонную артерию нейлоновую мононить с силиконовым покрытием (Doccol; 602134 PK10) помещали во внутреннюю сонную артерию, чтобы подтвердить снижение rCBF до 80% от его прежнего значения.Все данные, за исключением того, что на фиг. 4 J , были получены от мышей со снижением кровотока> 80%. Менее 10% мышей с MCAO имели снижение кровотока <80% и были исключены. На рис. 4 J мы использовали шесть мышей со снижением rCBF <80% для проверки того, может ли умеренное снижение кровотока в головном мозге снизить TAK1. После 60-минутной окклюзии нить и зажим извлекали, и мышей держали при 37 ° C в течение 30 минут. В модели инсульта с постоянной окклюзией мышей поддерживали с нитью внутри и имели ту же продолжительность анестезии и послеоперационной теплоизоляции.Для фиктивной хирургии все артерии были обнажены на период операции, но нить не была вставлена ​​достаточно глубоко, чтобы вызвать изменение rCBF. Хирургический период и объем анестезии были такими же, как и при операции MCAO.

Мышей наблюдали три раза в день в течение первых 24 часов, затем дважды в день в течение первой недели. Бупренорфин 0,08 мг / кг п / к. давали в период восстановления животным, проявлявшим признаки боли. Используя хиазму в качестве ориентира, для выделения белка и РНК использовали мозг от 1 мм кпереди до 2 мм кзади от инсульта.Каждый эксперимент повторялся более трех раз. В этом исследовании использовали мышей-самцов (возраст от 7 до 10 недель). Всего 112 мышей-самцов WT, 77 Ripk1 D138N / D138N мышей, 81 Ripk3 — / — самцов мышей, 53 MAP3K7 905 fl / fl / fl Lyz2 cre / + самцов мышей и 57 MAP3K7 fl / fl ; Emx cre / + самцов мышей подвергали процедуре MCAO.Смертность составила 4,4% (5 из 112) у мышей WT, 2,6% (2 из 77) у Ripk1 D138N / D138N мышей, 3,7% (3 из 81) у Ripk3 — / — мышей, 7,5% (4 из 53) в MAP3K7 fl / fl ; Lyz2 cre / + мышей и 5,2% (3 из 57) у Emx cre / + мышей. Между этими группами не было значительных различий в смертности. Ни одно животное не погибло в результате фиктивной процедуры.

Измерение объема инфаркта и кровотечения.

Мышей умерщвляли передозировкой изофлурана и транскардиально перфузировали PBS для удаления внутрисосудистой крови. Корональные срезы головного мозга (толщиной 1 мм) инкубировали в 1% растворе трифенилтетразолия хлорида (ТТС) (Sigma-Aldrich) при комнатной температуре в течение 20 мин. Объемы инфаркта определяли количественно с помощью программного обеспечения ImageJ. Мы использовали непрямой метод, чтобы устранить мешающие эффекты отека. Объемы инфаркта из каждого среза были объединены, чтобы получить общий объем ишемического поражения (38).С помощью тех же изображений мы определили поражения алыми точками в области ишемии как геморрагический инфаркт (37).

Измерение объема геморрагической крови.

Объем геморрагической крови определяли количественно спектрофотометрически с использованием набора QuantiChrom Hemoglobin Assay Kit (системы BioAssay) в соответствии с рекомендациями производителя. Концентрацию гемоглобина выражали в микрограммах на образец.

Количественная оценка иммуноокрашивания.

Срезы тканей иммуноокрашивали различными АТ, как указано в подписях к рисункам.Количественная оценка была проведена на пяти срезах от каждой мыши от ~ 100 до 150 клеток.

Антитела.

TAK1 (Cell Signaling Technology, каталожный номер 5206; Santa Cruz Biotechnology, каталожный номер sc166562), RIPK1 (BD Biosciences, каталожный номер 610459; Cell Signaling Technology, каталожный номер 3493), p-RIPK1 (S166) ( Cell Signaling Technology, номер по каталогу 31122; MJS BioLynx), CC3 (Cell Signaling Technology, номер по каталогу 9664), TNFR1 (Cell Signaling Technology, номер по каталогу 13377), IBA-1 (Wako, номер по каталогу.019–19741), NEUN (Millipore Sigma, MAB377X), RIPK3 (Abcam, каталожный номер ab72106), MLKL (Abcam, каталожный номер ab172868), p-RIPK3 (T231 / S232) (Cell Signaling Technology, каталожный номер 57220). ), p-MLKL (Cell Signaling Technology, каталожный номер 37333), LC3B (Cell Signaling Technology, каталожный номер 2775), p-p38 (Cell Signaling Technology, каталожный номер 9211), p38 (Cell Signaling Technology, номер в каталоге 9212), p-ERK (Cell Signaling Technology, номер в каталоге 4370) и ERK (Cell Signaling, номер в каталоге 9102)

Первичная культура микроглии.

Вкратце, передний мозг детенышей мыши в возрасте 1-2 дней переваривали 0,01% трипсином и растирали с DMEM, содержащей 10% инактивированного нагреванием FBS и 1% пенициллин-стрептомицин. Диссоциированные клетки высевали на покрытые поли-d-лизином 75-см колбы 2 и скармливали каждые 3 дня в течение 7-10 дней. После первоначального встряхивания культуры в течение 1 часа микроглию собирали и культивировали в среде DMEM + 10% FBS.

Первичная культура нейронов.

Вкратце, передний мозг эмбрионов E15 был переварен с помощью 0.01% трипсина и растирали с DMEM, содержащей 10% инактивированного нагреванием FBS и 1% пенициллин-стрептомицин. Диссоциированные клетки высевали на 24-луночный планшет, покрытый поли-d-лизином, при плотности 2 × 10 5 клеток / лунку с DMEM. На следующий день среду заменяли нейробазальной средой с 2% добавкой B27 (Thermo Fisher Scientific, номер в каталоге 17504044) и добавляли 5 мкМ цитокин арабинозид на 4 день. Нейроны собирали на 11 день.

Гистология. и иммунохимия.

Животных умерщвляли и перфузировали PBS, а затем 4% параформальдегидом, и 25 мкм поперечные срезы мозга получали на криостате.Для иммуноокрашивания срезы ткани собирали и блокировали 10% нормальной козьей сывороткой и 1% BSA, а затем инкубировали с первичными антителами при 4 ° C в течение ночи. Изображения были получены с помощью конфокального микроскопа Nikon Ti-E, оснащенного сканирующей головкой A1R со спектральным детектором и резонансными сканерами; изображения были получены с помощью программного обеспечения Nikon NIS-Elements. Для каждой точки изображения были собраны оптические срезы серии z с шагом 0,2 мкм с использованием фокусирующего двигателя Prior Scientific ProScan.Гамма, яркость и контраст были отрегулированы для отображаемых изображений (идентичных для сравниваемых наборов изображений) с помощью программного обеспечения Fiji.

Статистика и биоинформатика.

Различия считались статистически значимыми при P <0,05 (*), P <0,01 (**) или P <0,001 (***). Данные выражены как среднее значение ± стандартная ошибка среднего. Размеры выборки для исследований на животных определялись расчетом мощности на основе пилотных исследований. Для статистического анализа использовалась версия JMP 14.0.0.Парные сравнения между двумя группами проводились с использованием критерия Стьюдента t . Для множественных сравнений трех генотипов мы выполнили односторонний дисперсионный анализ, чтобы проанализировать разницу средних значений для непрерывных переменных с нормальным распределением. Двусторонний дисперсионный анализ ANOVA был проведен для анализа различий в средних значениях при множественных сравнениях с течением времени. Когда одно- или двухфакторный дисперсионный анализ показал значительные различия, попарные сравнения между средними значениями проверялись соответствующими апостериорными тестами. Оценка поведения проводилась двойным слепым методом, при этом человек не знал о предыдущем лечении или генотипах.

Доступность данных.

Все данные включены в рукопись SI и Приложение .

Каков прогноз дисфагии?

  • Палмер Дж. Б., Дукхейн А.С. Phys Med Rehab Clin North Amer. Реабилитация нарушений глотания в результате инсульта . 1991. 2: 529.

  • Patel DA, Krishnaswami S, Steger E, et al. Бремя дисфагии для экономики и выживания среди стационарных пациентов в США. Дис-Пищевод .1 января 2018 г. 31 (1): 1-7. [Медлайн].

  • Dodds WJ. Физиология глотания. Дисфагия . 1989. 3 (4): 171-8. [Медлайн].

  • Додрил П., Госа ММ. Детская дисфагия: физиология, оценка и лечение. Энн Нутр Метаб . 2015. 66 Дополнение 5: 24–31. [Медлайн]. [Полный текст].

  • Horton J, Atwood C, Gnagi S, Teufel R, Clemmens C. Временные тенденции детской дисфагии у госпитализированных пациентов. Дисфагия . 2018 20 февраля. [Medline].

  • Baxter KJ, Baxter LM, Landry AM, Wulkan ML, Bhatia AM. Структурные аномалии дыхательных путей способствуют развитию дисфагии у детей с атрезией пищевода и трахеопищеводной фистулой. Дж. Педиатр Хирургия . 2018 31 января. [Medline].

  • Christiaanse ME, Mabe B, Russell G, Simeone TL, Fortunato J, Rubin B. Нервно-мышечная электростимуляция не более эффективна, чем обычная помощь при лечении первичной дисфагии у детей. Пульмонол Педиатр . 2011 июн. 46 (6): 559-65. [Медлайн].

  • Shaker R, Kern M, Bardan E, Taylor A, Stewart ET, Hoffmann RG, et al. Увеличение глотательного отверстия верхнего сфинктера пищевода у пожилых людей с помощью упражнений. Am J Physiol . 1997, июнь 272 (6, часть 1): G1518-22. [Медлайн].

  • Paik NJ, Kim SJ, Lee HJ, Jeon JY, Lim JY, Han TR. Движение подъязычной кости и надгортанника при глотании у пациентов с дисфагией различной этиологии. Дж Электромиогр Кинезиол . 2008 апреля 18 (2): 329-35. [Медлайн].

  • Veis SL, Logemann JA. Нарушения глотания у лиц с нарушением мозгового кровообращения. Arch Phys Med Rehabil . 1985 июн 66 (6): 372-5. [Медлайн].

  • Logemann JA. Руководство по видеофлюорографическому исследованию глотания . 2-е изд. Остин, Техас: Pro-Ed; 1993.

  • Питтс Т., Больсер Д., Розенбек Дж., Троче М., Сапиенца К.Произвольная выработка кашля и дисфункция глотания при болезни Паркинсона. Дисфагия . 2008 23 сентября (3): 297-301. [Медлайн].

  • Кавагути С., Такеучи Т., Иноуэ Y и др. Изучение скрытых нарушений моторики пищевода у пациентов с дисфагией. Пищеварение . 2017 г. 11 апреля. 95 (4): 269-74. [Медлайн].

  • Power ML, Hamdy S, Singh S. Деглютативное закрытие гортани у пациентов с аспирационным инсультом. J Neurol Neurosurg Psychiatry .29 сен 2006.

  • Розенбек Дж. С., Роббинс Дж. А., Рокер Э. Б., Койл Дж. Л., Вуд Дж. Л.. Шкала проникновения-стремления. Дисфагия . 1996 Весна. 11 (2): 93-8. [Медлайн].

  • Kim H, Suh Y. Изменения дисфагии и статуса питания пациентов с черепно-мозговой травмой. Дж. Клин Нурс . 2017 г. 21 декабря [Medline].

  • Монтейро Л., Соуза-Мачадо А., Пинхо П., Сампайо М., Нобрега А.С., Мело А. Нарушение глотания и легочная дисфункция при болезни Паркинсона: скрытые угрозы. J Neurol Sci . 2014 14 февраля [Medline].

  • Andrenelli E, Galli FL, Gesuita R, et al. Нарушения глотания при боковом амиотрофическом склерозе и миотонической дистрофии 1 типа: поиск портрета пациента с дисфагией при нервно-мышечных заболеваниях. Нейрореабилитация . 2018. 42 (1): 93-102. [Медлайн].

  • Suntrup-Krueger S, Kemmling A, Warnecke T, et al. Влияние местоположения поражения на частоту, характер и осложнения дисфагии при остром инсульте.Часть 2: Остатки из ротоглотки, реакция глотания и кашля и пневмония. евро J Neurol . 2017 г. 27 апреля. [Medline].

  • Сантруп С., Кеммлинг А., Варнеке Т. и др. Влияние местоположения поражения на частоту, характер и осложнения дисфагии при остром инсульте. Часть 1: частота, тяжесть и аспирация дисфагии. евро J Neurol . 2015 май. 22 (5): 832-8. [Медлайн].

  • Ли Б., Ву П. Хронический кашель как признак сенсорной нейропатии гортани: диагностика и лечение. Энн Отол Ринол Ларингол . 2005 апр. 114 (4): 253-7. [Медлайн].

  • Clayton NA, Carnaby GD, Peters MJ, Ing AJ. Нарушение чувствительности гортани у пациентов с ХОБЛ: связь с функцией глотания. Int J Speech Lang Pathol . 2014 24 февраля [Medline].

  • Greven KM, White DR, Browne JD, Williams DW 3rd, McGuirt WF Sr, D’Agostino RB Jr. Дисфункция глотания является частым осложнением после химиолучевой терапии карциномы ротоглотки. Ам Дж. Клин Онкол . 31 июня 2008 г. (3): 209-12. [Медлайн].

  • Mackenzie SH, Go M, Chadwick B, Thomas K, Fang J, Kuwada S и др. Эозинофильный эзофагит у пациентов с дисфагией — проспективный анализ. Алимент Фармакол Тер . 2008 г., 1. 28 (9): 1140-6. [Медлайн].

  • Bussell SA, Гонсалес-Фернандес М. Расовые различия в развитии дисфагии после инсульта: дополнительные данные из базы данных Medicare. Arch Phys Med Rehabil . 2011 Май. 92 (5): 737-42. [Медлайн].

  • Gonzalez-Fernandez M, Kuhlemeier KV, Palmer JB. Расовые различия в развитии дисфагии после инсульта: анализ баз данных стационарных пациентов Калифорнии (MIRCal) и Нью-Йорка (SPARCS). Arch Phys Med Rehabil . 2008 июль 89 (7): 1358-65. [Медлайн].

  • Kooi-van Es M, Erasmus CE, de Swart BJM, et al. Дисфагия и дизартрия у детей с нервно-мышечными заболеваниями, исследование распространенности. J Neuromuscul Dis . 2020 11 марта [Medline].

  • Mann G, Hankey GJ, Cameron D. Функция глотания после инсульта: прогноз и прогностические факторы через 6 месяцев. Ход . 1999 Апрель 30 (4): 744-8. [Медлайн].

  • Барер DH. Естественное течение и функциональные последствия дисфагии после полушарного инсульта. J Neurol Neurosurg Psychiatry . 1989 Февраль 52 (2): 236-41. [Медлайн]. [Полный текст].

  • Masiero S, Pierobon R, Previato C, Gomiero E.Пневмония у пациентов с инсультом и ротоглоточной дисфагией: последующее шестимесячное исследование. Neurol Sci . 29 июня 2008 г. (3): 139-45. [Медлайн].

  • Оддерсон И.Р., Китон Дж. К., Маккенна Б.С. Управление глотанием у пациентов с острым инсультом: качество рентабельно. Arch Phys Med Rehabil . 1995 Декабрь 76 (12): 1130-3. [Медлайн].

  • Eglseer D, Halfens RJG, Schols JMGA, Lohrmann C. Дисфагия у госпитализированных пожилых пациентов: сопутствующие факторы и диетологические вмешательства. J Nutr Здоровье старения . 2018. 22 (1): 103-10. [Медлайн].

  • Finestone HM, Greene-Finestone LS, Wilson ES, Teasell RW. Недоедание у пациентов с инсультом, находящихся на реабилитационной службе и при последующем наблюдении: распространенность и предикторы. Arch Phys Med Rehabil . 1995 апр. 76 (4): 310-6. [Медлайн].

  • Gourin CG, Couch ME, Johnson JT. Влияние потери веса на краткосрочные результаты и затраты на лечение после операции по поводу рака головы и шеи. Энн Отол Ринол Ларингол . 2014 Февраль 123 (2): 101-10. [Медлайн].

  • Logemann JA. Оценка и лечение нарушений глотания . 2-е изд. Остин, Техас: Pro-Ed; 1998.

  • Палмер Дж. Б., Дреннан Дж. К., Баба М. Оценка и лечение нарушений глотания. Врач Фам . 2000, 15 апреля. 61 (8): 2453-62. [Медлайн].

  • Spieker MR. Оценка дисфагии. Врач Фам .2000, 15 июня. 61 (12): 3639-48. [Медлайн].

  • Kwek AB, Tan EK, Luman W. Дисфагия как побочный эффект инъекции ботулотоксина. Med J Malaysia . 2004 Октябрь 59 (4): 544-6. [Медлайн].

  • Lazarus C, Logemann JA. Нарушения глотания у больных с закрытой травмой головы. Arch Phys Med Rehabil . 1987 Февраль 68 (2): 79-84. [Медлайн].

  • DePippo KL, Holas MA, Reding MJ. Валидация теста с проглатыванием 3 унций воды на аспирацию после инсульта. Arch Neurol . 1992 Декабрь 49 (12): 1259-61. [Медлайн].

  • Кумар В.В., Амин МР. Оценка средних и дистальных дивертикулов пищевода с помощью трансназальной эзофагоскопии. Энн Отол Ринол Ларингол . 2005 апр. 114 (4): 276-8. [Медлайн].

  • Сплайнгард М.Л., Хатчинс Б., Султон Л.Д., Чаудхури Г. Аспирация у реабилитируемых пациентов: видеофлюороскопия и клиническая оценка у постели больного. Arch Phys Med Rehabil . 1988 Август.69 (8): 637-40. [Медлайн].

  • Espitalier F, Fanous A, Aviv J, et al. Международный консенсус (ICON) по оценке ротоглоточной дисфагии. Eur Ann Otorhinolaryngol Head Neck Dis . 2018 фев. 135 (1S): S17-S21. [Медлайн].

  • Шем К.Л., Кастильо К., Вонг С.Л., Чанг Дж., Као М.С., Колаковски-Хайнер С.А. Диагностическая точность прикроватной оценки глотания по сравнению с видеофлюороскопией для оценки дисфагии у лиц с тетраплегией. PM R .2012 апр. 4 (4): 283-9. [Медлайн].

  • Холт С., Мирон С.Д., Диаз М.С., Шилдс Р., Ингрэм Д., Беллон Э.М. Сцинтиграфическое измерение ротоглоточного транзита у человека. Dig Dis Sci . 1990 Октябрь 35 (10): 1198-204. [Медлайн].

  • Аддингтон В. Р., Стивенс Р. Е., Гиллиланд К., Родригес М. Оценка гортанного кашлевого рефлекса и риска развития пневмонии после инсульта. Arch Phys Med Rehabil . 1999 Февраль 80 (2): 150-4. [Медлайн].

  • Эртекин С., Айдогду I, Юджеяр Н., Тарлачи С., Кийлиоглу Н., Пехливан М. и др. Электродиагностические методы нейрогенной дисфагии. Электроэнцефалогер Клин Нейрофизиол . 1998 августа 109 (4): 331-40. [Медлайн].

  • Noll SF, Bender CE, Marge CN. Реабилитация больных с нарушением глотания. Брэддом Р.Л., изд. Физическая медицина и реабилитация . У. Б. Сондерс: Филадельфия, Пенсильвания; 1996.

  • Paik NJ, Han TR.Критический обзор управления ротоглоточной дисфагией у взрослых. Crit Rev Phys Rehabil Med . 2002. 14: 247-72.

  • Национальная целевая группа по диете при дисфагии. Национальная диета при дисфагии: стандартизация оптимального ухода . Чикаго, штат Иллинойс: Американская диетическая ассоциация; 2002.

  • Сьюэлл РК, Баумана Н.М. Врожденная перстно-глоточная ахалазия: лечение ботулотоксином перед миотомией. Arch Otolaryngol Head Neck Surg .2005 Май. 131 (5): 451-3. [Медлайн].

  • Sonies BC, Almajid P, Kleta R, Bernardini I, Gahl WA. Дисфункция глотания у 101 пациента с нефропатическим цистинозом: преимущества долгосрочной терапии цистеамином. Медицина (Балтимор) . 2005 Май. 84 (3): 137-46. [Медлайн].

  • Манн Л.Л., Вонг К. Разработка объективного метода оценки вязкости сформулированных пищевых продуктов и напитков для дисфагической диеты. J Am Diet Assoc .1996 июнь 96 (6): 585-8. [Медлайн].

  • Paik NJ, Han TR, Park JW, Lee EK, Park MS, Hwang IK. Категоризация диет при дисфагии с помощью теста на растяжение линии. Arch Phys Med Rehabil . 2004 Май. 85 (5): 857-61. [Медлайн].

  • Verschueren A, Monnier A, Attarian S, Lardillier D, Pouget J. Энтеральное и парентеральное питание на поздних стадиях БАС: обсервационное исследование. Боковой склер амиотрофа . 2009 Февраль 10 (1): 42-6. [Медлайн].

  • Choi JB, Shim SH, Yang JE, Kim HD, Lee DH, Park JS. Влияние упражнений на шейкер у выживших после инсульта с ротоглоточной дисфагией. Нейрореабилитация . 2017. 41 (4): 753-7. [Медлайн].

  • Fraser C, Power M, Hamdy S, Rothwell J, Hobday D, Hollander I, et al. Повышение пластичности моторной коры взрослого человека связано с улучшением моторной функции после травмы головного мозга. Нейрон . 2002 30 мая. 34 (5): 831-40. [Медлайн].

  • Фрид М.Л., Фрид Л., Чатберн Р.Л., Кристиан М. Электростимуляция при расстройствах глотания, вызванных инсультом. Respir Care . 2001 Май. 46 (5): 466-74. [Медлайн].

  • Leelamanit V, Limsakul C, Geater A. Синхронная электрическая стимуляция при лечении глоточной дисфагии. Ларингоскоп . 2002 декабрь 112 (12): 2204-10. [Медлайн].

  • Спросон Л., Паунолл С., Эндерби П., Фриман Дж. Комбинированная электрическая стимуляция и упражнения для реабилитации глотания после инсульта: пилотное рандомизированное контрольное исследование. Инт Дж. Ланг Коммуна Разногласие . 30 декабря 2017 г. [Medline].

  • Schultheiss C, Nusser-Müller-Busch R, Seidl RO. Полутвердый болюсный глотательный тест для клинической диагностики ротоглоточной дисфагии: проспективное рандомизированное исследование. Eur Arch Оториноларингол . 2011 Декабрь 268 (12): 1837-44. [Медлайн]. [Полный текст].

  • Ho CH, Lin WC, Hsu YF, Lee IH, Hung YC. Годовой риск пневмонии и смертности у пациентов с постинсультной дисфагией: общенациональное популяционное исследование. J Stroke Cerebrovasc Dis . 2018 25 января. [Medline].

  • Кэмпбелл-Тейлор И., Надон Г. В., Склейтер А. Л., Фишер Р., Харрис-Кван Дж., Розен И. Кормление через ротопищеводный зонд: альтернатива назогастральным или гастростомическим зондам. Дисфагия . 1988. 2 (4): 220-1. [Медлайн].

  • Park RH, Allison MC, Lang J, Spence E, Morris AJ, Danesh BJ и др. Рандомизированное сравнение чрескожной эндоскопической гастростомии и кормления через назогастральный зонд у пациентов с сохраняющейся неврологической дисфагией. BMJ . 1992 30 мая. 304 (6839): 1406-9. [Медлайн]. [Полный текст].

  • Gomes CA Jr, Lustosa SA, Matos D, Andriolo RB, Waisberg DR, Waisberg J. Чрескожная эндоскопическая гастростомия в сравнении с кормлением через назогастральный зонд для взрослых с нарушениями глотания. Кокрановская база данных Syst Rev . 2012 14 марта 3: CD008096. [Медлайн].

  • Han TR, Paik NJ, Park JW, Kwon BS. Прогнозирование стойкой дисфагии через шесть месяцев после инсульта. Дисфагия . 2008 23 марта (1): 59-64. [Медлайн].

  • Han TR, Paik NJ, Park JW. Количественная оценка функции глотания после инсульта: шкала функциональной дисфагии, основанная на видеофлюороскопических исследованиях. Arch Phys Med Rehabil . 2001 Май. 82 (5): 677-82. [Медлайн].

  • Дзевас Р., Варнеке Т., Оленберг С., Тейсманн И., Циммерманн Дж., Крамер С. и др. На пути к базовой эндоскопической оценке глотания при остром инсульте — разработка и оценка простой шкалы дисфагии. Цереброваск Дис . 2008. 26 (1): 41-7. [Медлайн].

  • Аспирин или антикоагулянтная терапия после криптогенного инсульта с открытым овальным отверстием: систематический обзор и метаанализ рандомизированных контролируемых исследований

    Введение

    Поскольку закрытие имеет ограничительные критерии приемлемости, подавляющее большинство пациентов с криптогенным инсультом и открытым овальным отверстием (PFO) получают Медицинское лечение. Однако оптимальная антитромботическая стратегия все еще не ясна.Мы провели систематический обзор и метаанализ рандомизированных контролируемых исследований (РКИ), чтобы определить профиль соотношения риск / польза антикоагулянтов по сравнению с антиагрегантным лечением при инсульте, связанном с ПФО.

    Методы

    Протокол систематического обзора был зарегистрирован в PROSPERO (CRD420159). Следуя рекомендациям PRISMA, мы провели поиск в базах данных MEDLINE, EMBASE и Cochrane CENTRAL (2000–2019) на предмет РКИ, в которых случайным образом распределялись пациенты с криптогенным инсультом и ПФО для лечения. Риск систематической ошибки оценивался с помощью инструмента Cochrane RoB.Основными исходами были рецидив инсульта и обширное кровотечение. Для определения возможной роли отбора пациентов был реализован анализ, зависящий от оценки RoPE.

    Результаты

    Пять РКИ соответствовали критериям включения (3 РКИ высокого качества, 1 удовлетворительное, 1 РКИ низкого качества). В целом метаанализ включал 1565 пациентов (средний возраст 55,5 лет), 753 (48,1%) получали антикоагулянты. По сравнению с антитромбоцитарной терапией, антикоагулянтная терапия не принесла чистой пользы в предотвращении повторного инсульта (OR = 0,66, 95% ДИ 0.

    Добавить комментарий

    Ваш адрес email не будет опубликован.